Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP44 cdna clone

USP44 cDNA Clone

Synonyms
USP44; USP44 cDNA Clone; USP44 cdna clone
Ordering
For Research Use Only!
Sequence
atgctagcaatggatacgtgcaaacatgttgggcagctgcagcttgctcaagaccattccagcctcaaccctcagaaatggcactgtgtggactgcaacacgaccgagtccatttgggcttgccttagctgctcccatgttgcctgtggaagatatattgaagagcatgcactcaagcactttcaagaaagcagtcatcctgttgcattggaggtgaatgagatgtacgttttttgttacctttgtgatgattatgttctgaatgataacgcaactggagacctgaagttactacgacgtacattaagtgccatcaaaagtcaaaattatcactgcacaactcgtagtgggaggtttttacggtccatgggtacaggtgatgattcttatttcttacatgacggtgcccaatctctgcttcaaagtgaagatcaactgtatactgctctttggcacaggagaaggatactaatgggtaaaatctttcgaacatggtttgaacaatcacccattggaagaaaaaagcaagaagaaccatttcaggaaaaaatagtagtaaaaagagaagtaaagaaaagacggcaggaattggagtatcaagttaaagcagaattggaaagtatgcctccaagaaagagtttacgtttacaagggctcgctcagtcgaccataatagaaatagtttctgttcaggtgccagcacaaacgccagcatcaccagcaaaagataaagtactctctacctcagaaaatgaaatatctcaaaaagtcagtgactcctcagttaaacgaaggccaatagtaactcctggtgtaacaggattgagaaatttgggaaatacttgctatatgaattctgttcttcaggtattgagtcatttacttatttttcgacaatgttttttaaagcttgatctgaaccaatggctggctatgactgctagcgagaagacaagatcttgtaagcatccaccagtcacagatacagtagtatatcaaatgaatgaatgtcaggaaaaagatacaggttttgtttgctccagacaatcaagtctgtcatcaggactaagtggtggagcatcaaaaggtagaaagatggaacttattcagccaaaggagccaacttcacagtacatttctctttgtcatgaattgcatactttgttccaagtcatgtggtctggaaagtgggcgttggtctcaccatttgctatgctacactcagtgtggagactcattcctgcctttcgtggttacgcccaacaagacgctcaggaatttctttgtgaacttttagataaaatacaacgtgaattagagacaactggtaccagtttaccagctcttatccccacttctcaaaggaaactcatcaaacaagttctgaatgttgtaaataacatttttcatggacaacttcttagtcaggttacatgtcttgcatgtgacaacaaatcaaataccatagaacctttctgggacttgtcattggagtttccagaaaggtatcaatgcagtggaaaagatattgcttcccagccatgtctggttactgaaatgttggccaaatttacagaaactgaagctttagaaggaaaaatctacgtatgtgaccagtgtaactcaaagcgtagaaggttttcctccaaaccagttgtactcacagaagcccagaaacaacttatgatatgccacctacctcaggttctcagactgcacctcaaacgattcaggtggtcaggacgtaataaccgagagaagattggtgttcatgttggctttgaggaaatcttaaacatggagccctattgctgcagggagaccctgaaatccctcagaccagaatgctttatctatgacttgtccgcggtggtgatgcaccatgggaaaggatttggctcagggcactacactgcctactgctataattctgaaggagggttctgggtacactgcaatgattccaaactaagcatgtgcactatggacgaagtatgcaaggctcaagcttatatcttgttttatacccaacgagttactgagaatggacattctaaacttttgcctccagagctcctgttggggagccaacatcccaatgaagacgctgatacctcgtctaatgaaatccttagctga
Sequence Length
2139
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,185 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 44, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 44
NCBI Official Symbol
USP44
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 44
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 44
UniProt Gene Name
USP44
UniProt Entry Name
UBP44_HUMAN

NCBI Description

Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP44 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Uniprot Description

USP44: Deubiquitinase that plays a key role in the spindle checkpoint by preventing premature anaphase onset. Acts by specifically mediating deubiquitination of CDC20, a negative regulator of the anaphase promoting complex/cyclosome (APC/C). Deubiquitination of CDC20 leads to stabilize the MAD2L1-CDC20- APC/C ternary complex (also named mitotic checkpoint), thereby preventing premature activation of the APC/C. Belongs to the peptidase C19 family. USP44 subfamily.

Protein type: Ubiquitin-specific protease; Protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 12q22

Cellular Component: microtubule cytoskeleton; nucleolus; nucleus

Molecular Function: protein binding; ubiquitin-specific protease activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein deubiquitination

Research Articles on USP44

Similar Products

Product Notes

The USP44 usp44 (Catalog #AAA1273369) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctagcaa tggatacgtg caaacatgtt gggcagctgc agcttgctca agaccattcc agcctcaacc ctcagaaatg gcactgtgtg gactgcaaca cgaccgagtc catttgggct tgccttagct gctcccatgt tgcctgtgga agatatattg aagagcatgc actcaagcac tttcaagaaa gcagtcatcc tgttgcattg gaggtgaatg agatgtacgt tttttgttac ctttgtgatg attatgttct gaatgataac gcaactggag acctgaagtt actacgacgt acattaagtg ccatcaaaag tcaaaattat cactgcacaa ctcgtagtgg gaggttttta cggtccatgg gtacaggtga tgattcttat ttcttacatg acggtgccca atctctgctt caaagtgaag atcaactgta tactgctctt tggcacagga gaaggatact aatgggtaaa atctttcgaa catggtttga acaatcaccc attggaagaa aaaagcaaga agaaccattt caggaaaaaa tagtagtaaa aagagaagta aagaaaagac ggcaggaatt ggagtatcaa gttaaagcag aattggaaag tatgcctcca agaaagagtt tacgtttaca agggctcgct cagtcgacca taatagaaat agtttctgtt caggtgccag cacaaacgcc agcatcacca gcaaaagata aagtactctc tacctcagaa aatgaaatat ctcaaaaagt cagtgactcc tcagttaaac gaaggccaat agtaactcct ggtgtaacag gattgagaaa tttgggaaat acttgctata tgaattctgt tcttcaggta ttgagtcatt tacttatttt tcgacaatgt tttttaaagc ttgatctgaa ccaatggctg gctatgactg ctagcgagaa gacaagatct tgtaagcatc caccagtcac agatacagta gtatatcaaa tgaatgaatg tcaggaaaaa gatacaggtt ttgtttgctc cagacaatca agtctgtcat caggactaag tggtggagca tcaaaaggta gaaagatgga acttattcag ccaaaggagc caacttcaca gtacatttct ctttgtcatg aattgcatac tttgttccaa gtcatgtggt ctggaaagtg ggcgttggtc tcaccatttg ctatgctaca ctcagtgtgg agactcattc ctgcctttcg tggttacgcc caacaagacg ctcaggaatt tctttgtgaa cttttagata aaatacaacg tgaattagag acaactggta ccagtttacc agctcttatc cccacttctc aaaggaaact catcaaacaa gttctgaatg ttgtaaataa catttttcat ggacaacttc ttagtcaggt tacatgtctt gcatgtgaca acaaatcaaa taccatagaa cctttctggg acttgtcatt ggagtttcca gaaaggtatc aatgcagtgg aaaagatatt gcttcccagc catgtctggt tactgaaatg ttggccaaat ttacagaaac tgaagcttta gaaggaaaaa tctacgtatg tgaccagtgt aactcaaagc gtagaaggtt ttcctccaaa ccagttgtac tcacagaagc ccagaaacaa cttatgatat gccacctacc tcaggttctc agactgcacc tcaaacgatt caggtggtca ggacgtaata accgagagaa gattggtgtt catgttggct ttgaggaaat cttaaacatg gagccctatt gctgcaggga gaccctgaaa tccctcagac cagaatgctt tatctatgac ttgtccgcgg tggtgatgca ccatgggaaa ggatttggct cagggcacta cactgcctac tgctataatt ctgaaggagg gttctgggta cactgcaatg attccaaact aagcatgtgc actatggacg aagtatgcaa ggctcaagct tatatcttgt tttataccca acgagttact gagaatggac attctaaact tttgcctcca gagctcctgt tggggagcca acatcccaat gaagacgctg atacctcgtc taatgaaatc cttagctga. It is sometimes possible for the material contained within the vial of "USP44, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.