Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP33 cdna clone

USP33 cDNA Clone

Gene Names
USP33; VDU1
Synonyms
USP33; USP33 cDNA Clone; USP33 cdna clone
Ordering
For Research Use Only!
Sequence
atgacaggatcaaattcacacataacgatattaaccttaaaggtgttacctcattttgaaagtcttgggaaacaggaaaaaattcctaacaaaatgtcagcttttcgaaatcattgtccacatttggattcagttggtgaaataacaaaagaagatttgatacaaaaatcccttggtacttgtcaggattgtaaagtccaaggaccaaatctttgggcatgtctggagaatagatgttcatatgttggctgtggtgaatcacaagtagatcacagcaccatacattctcaggagacaaagcattatctaactgtgaaccttaccactcttcgagtatggtgttatgcttgcagcaaagaagtatttttggataggaaattaggaactcagccttcattgcctcatgtaagacaacctcaccaaatacaagaaaacagtgtccaggattttaaaatacccagtaatacaacattaaaaactcctctggttgccgtatttgatgatctggatatagaagcggatgaagaagatgaacttagggccagaggtcttacaggtttgaaaaatattggaaatacttgttacatgaatgcagctttgcaggctctttctaattgcccacctttgacacagttttttcttgattgtggaggactagctcgaacagataagaaacctgccatttgtaaaagttatctcaaactaatgacagagctgtggcataaaagcaggccaggatctgttgtgcctactactctgtttcaaggaattaaaactgtaaatccaacatttcgggggtattctcagcaggatgctcaagaattccttcgatgtttaatggatttgcttcatgaagaattgaaagagcaagtcatggaagtagaagaagatccgcaaaccataaccactgaggagacaatggaagaagacaagagccagtcggatgtagattttcagtcttgtgaatcttgtagcaacagtgatagagcagaaaatgaaaatggctctagatgcttttctgaagataataatgaaacaacaatgttaattcaggatgatgaaaacaattcagaaatgtcaaaggattggcaaaaagagaagatgtgcaataagattaataaagtaaattctgaaggcgaatttgataaagatagagactctatatctgaaacagtcgacttaaacaaccaggaaactgtcaaagtgcaaatacacagcagagcttcagaatatatcactgatgtccattcgaatgacctgtctacaccacagatccttccatcaaatgaaggtgttaatccacgtttatcggcaagccctcctaaatcaggcaatttgtggccaggattggcaccaccacacaaaaaagctcagtctgcatctccaaagagaaaaaaacagcacaagaaatacagaagtgttatttcagacatatttgatggaacaatcattagttcagtgcagtgtctgacttgtgacagggtgtctgtaaccctcgagacctttcaagatctgtccttgccaattcctggcaaggaagaccttgctaagctgcattcatcaagtcatccaacttctatagtcaaagcaggatcatgtggcgaagcatatgctccacaagggtggatagcttttttcatggaatatgtgaagagctggttttggggtccagtagtaaccttgcaagattgtcttgctgccttctttgccagagatgaactaaaaggtgacaatatgtacagttgtgaaaaatgcaaaaagttgagaaatggagtgaagttttgtaaagtacaaaactttcctgagattttgtgcatccaccttaaaagattcagacatgaactaatgttttccaccaaaatcagtacccatgtttcatttccgctagaaggcttggatcttcagccatttcttgctaaggatagtccagctcaaattgtgacatatgatcttctgtcagtcatttgccatcatggaactgcaagtagtggacactatatagcctactgccgaaacaatctaaataatctctggtatgaatttgatgatcagagtgtcactgaagtttcagaatctactgtacaaaatgcagaagcttacgttcttttctataggaagagcagcgaagaggcacaaaaagagaggagaaggatatcaaatttattgaacataatggaaccaagcctccttcagttttatatttctcgacagtggcttaataaatttaagacctttgccgaacctggccctatttcaaataatgactttctttgtattcatggaggtgttcctccaagaaaagctggttatattgaagacctggttttgatgctgcctcagaacatttgggataacctatatagcaggtatggtggaggaccagctgtcaaccatctgtacatttgtcatacttgccaaattgaggcggagaaaattgaaaaaagaagaaaaactgaattggaaatttttattcgggtaaaaaagtga
Sequence Length
2487
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,957 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 33, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 33
NCBI Official Symbol
USP33
NCBI Official Synonym Symbols
VDU1
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 33
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 33
UniProt Gene Name
USP33
UniProt Synonym Gene Names
KIAA1097; VDU1; hVDU1
UniProt Entry Name
UBP33_HUMAN

NCBI Description

This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]

Uniprot Description

USP33: Deubiquitinating enzyme involved in various processes such as cellular migration and beta-2 adrenergic receptor/ADRB2 recycling. Involved in cell migration via its interaction with intracellular domain of ROBO1, leading to regulate the Slit signaling. Plays a role in commissural axon guidance cross the ventral midline of the neural tube in a Slit-dependent manner, possibly by mediating the deubiquitination of ROBO1. Acts as a regulator of G-protein coupled receptor (GPCR) signaling by mediating the deubiquitination of beta-arrestins (ARRB1 and ARRB2) and beta-2 adrenergic receptor (ADRB2). Plays a central role in ADRB2 recycling and resensitization after prolonged agonist stimulation by constitutively binding ADRB2, mediating deubiquitination of ADRB2 and inhibiting lysosomal trafficking of ADRB2. Upon dissociation, it is probably transferred to the translocated beta-arrestins, leading to beta-arrestins deubiquitination and disengagement from ADRB2. This suggests the existence of a dynamic exchange between the ADRB2 and beta- arrestins. Deubiquitinates DIO2, thereby regulating thyroid hormone regulation. Mediates deubiquitination of both 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. Belongs to the peptidase C19 family. USP20/USP33 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Ubiquitin conjugating system; EC 3.4.19.12; Ubiquitin-specific protease

Chromosomal Location of Human Ortholog: 1p31.1

Cellular Component: autophagic vacuole; centrosome; cytoplasm; focal adhesion; Golgi apparatus; nucleoplasm; perinuclear region of cytoplasm; VCB complex

Molecular Function: cysteine-type endopeptidase activity; G-protein-coupled receptor binding; protein binding; Ral GTPase binding; ubiquitin binding; ubiquitin-specific protease activity; zinc ion binding

Biological Process: axon guidance; cell migration; cellular response to starvation; centrosome duplication; negative regulation of protein binding; positive regulation of protein binding; protein deubiquitination; protein stabilization; regulation of autophagy; regulation of G-protein coupled receptor protein signaling pathway; ubiquitin-dependent protein catabolic process

Research Articles on USP33

Similar Products

Product Notes

The USP33 usp33 (Catalog #AAA1276158) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaggat caaattcaca cataacgata ttaaccttaa aggtgttacc tcattttgaa agtcttggga aacaggaaaa aattcctaac aaaatgtcag cttttcgaaa tcattgtcca catttggatt cagttggtga aataacaaaa gaagatttga tacaaaaatc ccttggtact tgtcaggatt gtaaagtcca aggaccaaat ctttgggcat gtctggagaa tagatgttca tatgttggct gtggtgaatc acaagtagat cacagcacca tacattctca ggagacaaag cattatctaa ctgtgaacct taccactctt cgagtatggt gttatgcttg cagcaaagaa gtatttttgg ataggaaatt aggaactcag ccttcattgc ctcatgtaag acaacctcac caaatacaag aaaacagtgt ccaggatttt aaaataccca gtaatacaac attaaaaact cctctggttg ccgtatttga tgatctggat atagaagcgg atgaagaaga tgaacttagg gccagaggtc ttacaggttt gaaaaatatt ggaaatactt gttacatgaa tgcagctttg caggctcttt ctaattgccc acctttgaca cagttttttc ttgattgtgg aggactagct cgaacagata agaaacctgc catttgtaaa agttatctca aactaatgac agagctgtgg cataaaagca ggccaggatc tgttgtgcct actactctgt ttcaaggaat taaaactgta aatccaacat ttcgggggta ttctcagcag gatgctcaag aattccttcg atgtttaatg gatttgcttc atgaagaatt gaaagagcaa gtcatggaag tagaagaaga tccgcaaacc ataaccactg aggagacaat ggaagaagac aagagccagt cggatgtaga ttttcagtct tgtgaatctt gtagcaacag tgatagagca gaaaatgaaa atggctctag atgcttttct gaagataata atgaaacaac aatgttaatt caggatgatg aaaacaattc agaaatgtca aaggattggc aaaaagagaa gatgtgcaat aagattaata aagtaaattc tgaaggcgaa tttgataaag atagagactc tatatctgaa acagtcgact taaacaacca ggaaactgtc aaagtgcaaa tacacagcag agcttcagaa tatatcactg atgtccattc gaatgacctg tctacaccac agatccttcc atcaaatgaa ggtgttaatc cacgtttatc ggcaagccct cctaaatcag gcaatttgtg gccaggattg gcaccaccac acaaaaaagc tcagtctgca tctccaaaga gaaaaaaaca gcacaagaaa tacagaagtg ttatttcaga catatttgat ggaacaatca ttagttcagt gcagtgtctg acttgtgaca gggtgtctgt aaccctcgag acctttcaag atctgtcctt gccaattcct ggcaaggaag accttgctaa gctgcattca tcaagtcatc caacttctat agtcaaagca ggatcatgtg gcgaagcata tgctccacaa gggtggatag cttttttcat ggaatatgtg aagagctggt tttggggtcc agtagtaacc ttgcaagatt gtcttgctgc cttctttgcc agagatgaac taaaaggtga caatatgtac agttgtgaaa aatgcaaaaa gttgagaaat ggagtgaagt tttgtaaagt acaaaacttt cctgagattt tgtgcatcca ccttaaaaga ttcagacatg aactaatgtt ttccaccaaa atcagtaccc atgtttcatt tccgctagaa ggcttggatc ttcagccatt tcttgctaag gatagtccag ctcaaattgt gacatatgat cttctgtcag tcatttgcca tcatggaact gcaagtagtg gacactatat agcctactgc cgaaacaatc taaataatct ctggtatgaa tttgatgatc agagtgtcac tgaagtttca gaatctactg tacaaaatgc agaagcttac gttcttttct ataggaagag cagcgaagag gcacaaaaag agaggagaag gatatcaaat ttattgaaca taatggaacc aagcctcctt cagttttata tttctcgaca gtggcttaat aaatttaaga cctttgccga acctggccct atttcaaata atgactttct ttgtattcat ggaggtgttc ctccaagaaa agctggttat attgaagacc tggttttgat gctgcctcag aacatttggg ataacctata tagcaggtat ggtggaggac cagctgtcaa ccatctgtac atttgtcata cttgccaaat tgaggcggag aaaattgaaa aaagaagaaa aactgaattg gaaattttta ttcgggtaaa aaagtga. It is sometimes possible for the material contained within the vial of "USP33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.