Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

URM1 cdna clone

URM1 cDNA Clone

Gene Names
URM1; C9orf74; RP11-339B21.4
Synonyms
URM1; URM1 cDNA Clone; URM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcgcccttgtcagtggaggtggagttcggaggtggtgcggagctcctgtttgacggtattaagaaacatcgagtcactttgcctggacaggaggaaccctgggacatccggaacctgctcatctggatcaagaagaatttgctaaaagagcggccagagttgttcatccagggagacagcgtgcggccaggaattctggtgctgattaacgatgccgactgggagctactgggtgagctggactaccagcttcaggaccaggacagcgtcctcttcatctccactctgcacggcggctga
Sequence Length
306
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
11,380 Da
NCBI Official Full Name
Homo sapiens ubiquitin related modifier 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ubiquitin related modifier 1
NCBI Official Symbol
URM1
NCBI Official Synonym Symbols
C9orf74; RP11-339B21.4
NCBI Protein Information
ubiquitin-related modifier 1 homolog; ubiquitin related modifier 1 homolog
UniProt Protein Name
Ubiquitin-related modifier 1 homolog
UniProt Gene Name
URM1
UniProt Synonym Gene Names
C9orf74
UniProt Entry Name
URM1_HUMAN

Uniprot Description

URM1: Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2-thiolation reaction by thiocarboxylated (-COSH) at its C-terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. May also act as an ubiquitin-like protein that is covalently conjugated to other proteins; the relevance of such function is however unclear in vivo. Belongs to the URM1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin-like modifier; Transferase

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: cytosol

Molecular Function: sulfurtransferase activity; protein binding

Biological Process: protein urmylation; tRNA wobble uridine modification

Research Articles on URM1

Similar Products

Product Notes

The URM1 urm1 (Catalog #AAA1272823) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgc ccttgtcagt ggaggtggag ttcggaggtg gtgcggagct cctgtttgac ggtattaaga aacatcgagt cactttgcct ggacaggagg aaccctggga catccggaac ctgctcatct ggatcaagaa gaatttgcta aaagagcggc cagagttgtt catccaggga gacagcgtgc ggccaggaat tctggtgctg attaacgatg ccgactggga gctactgggt gagctggact accagcttca ggaccaggac agcgtcctct tcatctccac tctgcacggc ggctga. It is sometimes possible for the material contained within the vial of "URM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.