UCHL5 cdna clone
UCHL5 cDNA Clone
Gene Names
UCHL5; UCH37; CGI-70; INO80R; UCH-L5
Synonyms
UCHL5; UCHL5 cDNA Clone; UCHL5 cdna clone
Sequence
atgacgggcaatgccggggagtggtgcctcatggaaagcgaccccggggtcttcaccgagctcattaaaggattcggttgccgaggagcccaagtagaagaaatatggagtttagagcctgagaattttgaaaaattaaagccagttcatgggttaatttttcttttcaagtggcagccaggagaagaaccagcaggctctgtggttcaggactcccgacttgacacgatattttttgctaagcaggtaattaataatgcttgtgctactcaagccatagtgagtgtgttactgaactgtacccaccaggatgtccatttaggcgagacattatcagagtttaaagaattttcacaaagttttgatgcagctatgaaaggcttggcactgagcaattcagatgtgattcgacaagtacacaacagtttcgccagacagcaaatgtttgaatttgatacgaagacatcagcaaaagaagaagatgcttttcactttgtcagttatgttcctgttaatgggagactgtatgaattagatggattaagagaaggaccgattgatttaggtgcatgcaatcaagatgattggatcagtgcagtaaggcctgtcatagaaaaaaggatacaaaagtacagtgaaggtgaaattcgatttaatttaatggccattgtgtctgacagaaaaatgatatatgagcagaagatagcagagttacaaagacaacttgcagaggaacccatggatacagatcaaggtaatagtatgttaagtgctattcagtcagaagttgccaaaaatcagatgcttattgaagaagaagtacagaaattaaaaagatacaagattgagaatatcagaaggaagcataattatctgcctttcattatggaattgttaaagactttagcagaacaccagcagttaataccactagtagaaaagtttgagaaacactttgagaagacactactaggcaaataa
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,353 Da
NCBI Official Full Name
Homo sapiens ubiquitin carboxyl-terminal hydrolase L5, mRNA
NCBI Official Synonym Full Names
ubiquitin C-terminal hydrolase L5
NCBI Official Symbol
UCHL5
NCBI Official Synonym Symbols
UCH37; CGI-70; INO80R; UCH-L5
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase isozyme L5
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase isozyme L5
Protein Family
UniProt Gene Name
UCHL5
UniProt Synonym Gene Names
UCH37; UCH-L5
UniProt Entry Name
UCHL5_HUMAN
Uniprot Description
UCHL5: Protease that specifically cleaves 'Lys-48'-linked polyubiquitin chains. Deubiquitinating enzyme associated with the 19S regulatory subunit of the 26S proteasome. Putative regulatory component of the INO80 complex; however is inactive in the INO80 complex and is activated by a transient interaction of the INO80 complex with the proteasome via ADRM1. Belongs to the peptidase C12 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Protease; Ubiquitin conjugating system; EC 3.4.19.12; Ubiquitin-specific protease
Chromosomal Location of Human Ortholog: 1q32
Cellular Component: cytosol; nucleus
Molecular Function: endopeptidase inhibitor activity; protein binding; ubiquitin-specific protease activity
Biological Process: protein deubiquitination
Research Articles on UCHL5
Similar Products
Product Notes
The UCHL5 uchl5 (Catalog #AAA1273829) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgggca atgccgggga gtggtgcctc atggaaagcg accccggggt cttcaccgag ctcattaaag gattcggttg ccgaggagcc caagtagaag aaatatggag tttagagcct gagaattttg aaaaattaaa gccagttcat gggttaattt ttcttttcaa gtggcagcca ggagaagaac cagcaggctc tgtggttcag gactcccgac ttgacacgat attttttgct aagcaggtaa ttaataatgc ttgtgctact caagccatag tgagtgtgtt actgaactgt acccaccagg atgtccattt aggcgagaca ttatcagagt ttaaagaatt ttcacaaagt tttgatgcag ctatgaaagg cttggcactg agcaattcag atgtgattcg acaagtacac aacagtttcg ccagacagca aatgtttgaa tttgatacga agacatcagc aaaagaagaa gatgcttttc actttgtcag ttatgttcct gttaatggga gactgtatga attagatgga ttaagagaag gaccgattga tttaggtgca tgcaatcaag atgattggat cagtgcagta aggcctgtca tagaaaaaag gatacaaaag tacagtgaag gtgaaattcg atttaattta atggccattg tgtctgacag aaaaatgata tatgagcaga agatagcaga gttacaaaga caacttgcag aggaacccat ggatacagat caaggtaata gtatgttaag tgctattcag tcagaagttg ccaaaaatca gatgcttatt gaagaagaag tacagaaatt aaaaagatac aagattgaga atatcagaag gaagcataat tatctgcctt tcattatgga attgttaaag actttagcag aacaccagca gttaatacca ctagtagaaa agtttgagaa acactttgag aagacactac taggcaaata a. It is sometimes possible for the material contained within the vial of "UCHL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
