UBR2 cdna clone
UBR2 cDNA Clone
Synonyms
UBR2; UBR2 cDNA Clone; UBR2 cdna clone
Sequence
atggcgtcggagctagagccagaggtgcaggccatcgaccggagcttgctggaatgttcggccgaggagattgcggggaaatggctgcaagcaactgacctcactagagaagtgtaccagcatttagcccactatgtacccaaaatctactgcaggggtcccaacccttttccacagaaagaagacatgctggcacagcatgttttgttgggaccaatggaatggtacctttgtggtgaagatcctgcatttggatttccaaaacttgagcaagcaaacaaaccttctcatctttgtggtcgtgtttttaaagtaggagagcctacatattcttgcagagactgtgcagttgatccaacttgtgttttgtgcatggagtgctttttgggaagtattcacagagatcatcgatataggatgacaacatcaggaggtggaggtttctgtgactgtggtgatactgaagcctggaaagagggtccttactgtcaaaaacatgaacttaacacctctgaaattgaggaagaagaggatcctcttgttcatttatcagaagatgtgatagcaagaacttataacatttttgctattacgtttcggtatgcagtagaaatattaacctgggaaaaagaaagtgaattgccagcagatttagagatggtagagaagagtgacacctactattgcatgctgtttaatgatgaggttcacacctacgaacaagttatttatactcttcagaaagctgttaactgtacacaaaaagaagctattggttttgcaactacagtagatcgagatgggcgtaggtctgttcgatatggagattttcagtattgtgagcaagcaaaatcagtaattgtgagaaataccagtagacagacaaagccactcaaagttcaagttatgcattcgtctattgtcgcacatcagaattttggtttgaaacttttgtcttggctgggaagtattattggatattcagatggccttcgccggattttatgtcaagttggtttacaagaagggccagatggtgaaaactcttctctagtggacagactgatgcttagtgattccaaattatggaaaggtgctaggagtgtatatcatcagttgttcatgagcagtctgcttatggatttgaaatacaagaaactatttgctgttcgatttgcaaaaaactatgagcgtttgcagagtgattatgtgacagatgaccacgacagagagttttcagtcgcagacctctcggttcagatattcacggttccttcacttttctctatctctgctgggcgcagtggctcacctctgtaa
Sequence Length
1320
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
200,540 Da
NCBI Official Full Name
Homo sapiens ubiquitin protein ligase E3 component n-recognin 2, mRNA
UniProt Protein Name
E3 ubiquitin-protein ligase UBR2
Protein Family
UniProt Gene Name
UBR2
UniProt Synonym Gene Names
C6orf133; KIAA0349
UniProt Entry Name
UBR2_HUMAN
Uniprot Description
UBR2: E3 ubiquitin-protein ligase which is a component of the N-end rule pathway. Recognizes and binds to proteins bearing specific N-terminal residues that are destabilizing according to the N-end rule, leading to their ubiquitination and subsequent degradation. Plays a critical role in chromatin inactivation and chromosome-wide transcriptional silencing during meiosis via ubiquitination of histone H2A. Binds leucine and is a negative regulator of the leucine-mTOR signaling pathway, thereby controlling cell growth. Belongs to the UBR1 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; EC 6.3.2.-; Ubiquitin ligase; EC 6.3.2.19; Ligase
Chromosomal Location of Human Ortholog: 6p21.1
Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane; ubiquitin ligase complex
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: chromatin silencing; histone H2A ubiquitination; negative regulation of TOR signaling pathway; protein polyubiquitination
Similar Products
Product Notes
The UBR2 ubr2 (Catalog #AAA1266608) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcgg agctagagcc agaggtgcag gccatcgacc ggagcttgct ggaatgttcg gccgaggaga ttgcggggaa atggctgcaa gcaactgacc tcactagaga agtgtaccag catttagccc actatgtacc caaaatctac tgcaggggtc ccaacccttt tccacagaaa gaagacatgc tggcacagca tgttttgttg ggaccaatgg aatggtacct ttgtggtgaa gatcctgcat ttggatttcc aaaacttgag caagcaaaca aaccttctca tctttgtggt cgtgttttta aagtaggaga gcctacatat tcttgcagag actgtgcagt tgatccaact tgtgttttgt gcatggagtg ctttttggga agtattcaca gagatcatcg atataggatg acaacatcag gaggtggagg tttctgtgac tgtggtgata ctgaagcctg gaaagagggt ccttactgtc aaaaacatga acttaacacc tctgaaattg aggaagaaga ggatcctctt gttcatttat cagaagatgt gatagcaaga acttataaca tttttgctat tacgtttcgg tatgcagtag aaatattaac ctgggaaaaa gaaagtgaat tgccagcaga tttagagatg gtagagaaga gtgacaccta ctattgcatg ctgtttaatg atgaggttca cacctacgaa caagttattt atactcttca gaaagctgtt aactgtacac aaaaagaagc tattggtttt gcaactacag tagatcgaga tgggcgtagg tctgttcgat atggagattt tcagtattgt gagcaagcaa aatcagtaat tgtgagaaat accagtagac agacaaagcc actcaaagtt caagttatgc attcgtctat tgtcgcacat cagaattttg gtttgaaact tttgtcttgg ctgggaagta ttattggata ttcagatggc cttcgccgga ttttatgtca agttggttta caagaagggc cagatggtga aaactcttct ctagtggaca gactgatgct tagtgattcc aaattatgga aaggtgctag gagtgtatat catcagttgt tcatgagcag tctgcttatg gatttgaaat acaagaaact atttgctgtt cgatttgcaa aaaactatga gcgtttgcag agtgattatg tgacagatga ccacgacaga gagttttcag tcgcagacct ctcggttcag atattcacgg ttccttcact tttctctatc tctgctgggc gcagtggctc acctctgtaa. It is sometimes possible for the material contained within the vial of "UBR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
