UBE2Q2 cdna clone
UBE2Q2 cDNA Clone
Synonyms
UBE2Q2; UBE2Q2 cDNA Clone; UBE2Q2 cdna clone
Sequence
atggaacttctcacaaaacagggctggagcagtgcctactcaatagaatcggtcatcatgcaaataaatgccaccttagtcaaaggcaaagccagagtgcagtttggagcaaataagaatcaatataatctagcaagagcccaacaatcctataattccattgtacagatacatgagaaaaatggctggtacacccctccaaaggaagatggctaa
Sequence Length
216
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,699 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2Q family member 2, mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 Q2
NCBI Official Symbol
UBE2Q2
NCBI Protein Information
ubiquitin-conjugating enzyme E2 Q2
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 Q2
Protein Family
UniProt Gene Name
UBE2Q2
UniProt Entry Name
UB2Q2_HUMAN
Uniprot Description
UBE2Q2: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys- 48'-linked polyubiquitination. Belongs to the ubiquitin-conjugating enzyme family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ligase; EC 6.3.2.19; Ubiquitin conjugating system; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 15q24.2
Molecular Function: ubiquitin-protein ligase activity
Research Articles on UBE2Q2
Similar Products
Product Notes
The UBE2Q2 ube2q2 (Catalog #AAA1277092) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacttc tcacaaaaca gggctggagc agtgcctact caatagaatc ggtcatcatg caaataaatg ccaccttagt caaaggcaaa gccagagtgc agtttggagc aaataagaat caatataatc tagcaagagc ccaacaatcc tataattcca ttgtacagat acatgagaaa aatggctggt acacccctcc aaaggaagat ggctaa. It is sometimes possible for the material contained within the vial of "UBE2Q2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
