Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2I cdna clone

UBE2I cDNA Clone

Gene Names
UBE2I; P18; UBC9; C358B7.1
Synonyms
UBE2I; UBE2I cDNA Clone; UBE2I cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatcttcgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatacaggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactggttagtagcagccctggccccgctggtggcagctcctccccgtcccagccaaggccgcctggcaggacgggagtggagcacacaggctcaccctagggacagccagggtccgcgcctctgtggggaaggtcggggggcataa
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,007 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 I
NCBI Official Symbol
UBE2I
NCBI Official Synonym Symbols
P18; UBC9; C358B7.1
NCBI Protein Information
SUMO-conjugating enzyme UBC9
UniProt Protein Name
SUMO-conjugating enzyme UBC9
UniProt Gene Name
UBE2I
UniProt Synonym Gene Names
UBC9; UBCE9
UniProt Entry Name
UBC9_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

UBC9: Accepts the ubiquitin-like proteins SUMO1, SUMO2, SUMO3 and SUMO4 from the UBLE1A-UBLE1B E1 complex and catalyzes their covalent attachment to other proteins with the help of an E3 ligase such as RANBP2 or CBX4. Can catalyze the formation of poly- SUMO chains. Necessary for sumoylation of FOXL2 and KAT5. Essential for nuclear architecture and chromosome segregation. Interacts with HIPK1, HIPK2, PPM1J, RASD2 and TCF3 Interacts with NR2C1; the interaction promotes its sumoylation. Forms a tight complex with RANGAP1 and RANBP2. Interacts with SIAH1 and PARP. Interacts with various transcription factors such as TFAP2A, TFAP2B, TFAP2C, AR, ETS1 and SOX4. Interacts with RWDD3; the interaction enhances the sumoylation of a number of proteins such as HIF1A and I-kappa-B. Interacts with DNMT1. Interacts with FOXL2. Forms a complex with SENP6 and UBE2I in response to UV irradiation. Interacts with human herpesvirus 6 IE2. Interacts with human adenovirus early E1A protein; this interaction interferes with polysumoylation (Probable). Interacts with DNM1l (via its GTPase and B domains); the interaction promotes sumoylation of DNM1L, mainly in its B domain. Interacts with PML-RARA oncoprotein (via the coiled-colied domain); the interaction is required for sumoylation of the PML- RARA oncoprotein. Interacts with IPO13. Interacts with NFATC2IP; this inhibits formation of poly-SUMO chains. Expressed in heart, skeletal muscle, pancreas, kidney, liver, lung, placenta and brain. Also expressed in testis and thymus. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: Ubiquitin ligase; Nuclear receptor co-regulator; EC 6.3.2.19; EC 6.3.2.-; SUMO conjugating system; Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytoplasm; cytosol; nuclear envelope; nucleoplasm; nucleus; PML body; synaptonemal complex

Molecular Function: enzyme binding; protein binding; SUMO ligase activity; transcription factor binding; ubiquitin protein ligase binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; protein modification process; protein sumoylation; ubiquitin-dependent protein catabolic process

Research Articles on UBE2I

Similar Products

Product Notes

The UBE2I ube2i (Catalog #AAA1269435) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggga tcgccctcag cagactcgcc caggagagga aagcatggag gaaagaccac ccatttggtt tcgtggctgt cccaacaaaa aatcccgatg gcacgatgaa cctcatgaac tgggagtgcg ccattccagg aaagaaaggg actccgtggg aaggaggctt gtttaaacta cggatgcttt tcaaagatga ttatccatct tcgccaccaa aatgtaaatt cgaaccacca ttatttcacc cgaatgtgta cccttcgggg acagtgtgcc tgtccatctt agaggaggac aaggactgga ggccagccat cacaatcaaa cagatcctat taggaataca ggaacttcta aatgaaccaa atatccaaga cccagctcaa gcagaggcct acacgattta ctggttagta gcagccctgg ccccgctggt ggcagctcct ccccgtccca gccaaggccg cctggcagga cgggagtgga gcacacaggc tcaccctagg gacagccagg gtccgcgcct ctgtggggaa ggtcgggggg cataa. It is sometimes possible for the material contained within the vial of "UBE2I, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.