Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2C cdna clone

UBE2C cDNA Clone

Gene Names
UBE2C; UBCH10; dJ447F3.2
Synonyms
UBE2C; UBE2C cDNA Clone; UBE2C cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcccaaaaccgcgacccagccgccactagcgtcgccgccgcccgtaaaggagctgagccgagcgggggcgccgcccggggtccggtgggcaaaaggctacagcaggagctgatgaccctcatgatgtctggcgataaagggatttctgccttccctgaatcagacaaccttttcaaatgggtagggaccatccatggagcagctggaacagtatatgaagacctgaggtataagctctcgctagagttccccagtggctacccttacaatgcgcccacagtgaagttcctcacgccctgctatcaccccaacgtggacacccagggtaacatatgcctggacatcctgaaggaaaagtggtctgccctgtatgatgtcaggaccattctgctctccatccagagccttctaggagaacccaacattgatagtcccttgaacacacatgctgccgagctctggaaaaaccccacagcttttaagaagtacctgcaagaaacctactcaaagcaggtcaccagccaggagccctga
Sequence Length
540
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,373 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2C, mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 C
NCBI Official Symbol
UBE2C
NCBI Official Synonym Symbols
UBCH10; dJ447F3.2
NCBI Protein Information
ubiquitin-conjugating enzyme E2 C
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 C
UniProt Gene Name
UBE2C
UniProt Synonym Gene Names
UBCH10
UniProt Entry Name
UBE2C_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]

Uniprot Description

UBE2C: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys- 11'- and 'Lys-48'-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by initiating 'Lys-11'-linked polyubiquitin chains on APC/C substrates, leading to the degradation of APC/C substrates by the proteasome and promoting mitotic exit. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: Cell cycle regulation; Ubiquitin ligase; EC 6.3.2.19; Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: anaphase-promoting complex; cytoplasm; cytosol; nucleoplasm

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cyclin catabolic process; exit from mitosis; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of exit from mitosis; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of mitotic metaphase/anaphase transition; regulation of ubiquitin-protein ligase activity during mitotic cell cycle; ubiquitin-dependent protein catabolic process

Research Articles on UBE2C

Similar Products

Product Notes

The UBE2C ube2c (Catalog #AAA1275107) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttccc aaaaccgcga cccagccgcc actagcgtcg ccgccgcccg taaaggagct gagccgagcg ggggcgccgc ccggggtccg gtgggcaaaa ggctacagca ggagctgatg accctcatga tgtctggcga taaagggatt tctgccttcc ctgaatcaga caaccttttc aaatgggtag ggaccatcca tggagcagct ggaacagtat atgaagacct gaggtataag ctctcgctag agttccccag tggctaccct tacaatgcgc ccacagtgaa gttcctcacg ccctgctatc accccaacgt ggacacccag ggtaacatat gcctggacat cctgaaggaa aagtggtctg ccctgtatga tgtcaggacc attctgctct ccatccagag ccttctagga gaacccaaca ttgatagtcc cttgaacaca catgctgccg agctctggaa aaaccccaca gcttttaaga agtacctgca agaaacctac tcaaagcagg tcaccagcca ggagccctga. It is sometimes possible for the material contained within the vial of "UBE2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.