UBAC2 cdna clone
UBAC2 cDNA Clone
Gene Names
UBAC2; PHGDHL1
Synonyms
UBAC2; UBAC2 cDNA Clone; UBAC2 cdna clone
Sequence
ATGCAGTATTTCTTTGGCATCACTGCAGCTAGTAATTTGCCTTCTGGATTCCTGGCACCTGTGTTTGCTCTGTTTGTACCATTTTACTGCTCCATACCAAGAGTCCAAGTGGCACAAATTCTGGGTCCGTTGTCCATCACAAACAAGACATTGATTTATATATTGGGACTGCAGCTTTTCACCTCTGGTTCCTACATCTGGATTGTAGCCATAAGTGGACTTATGTCCGGTCTGTGCTACGACAGCAAAATGTTCCAGGTGCATCAGGTGCTCTGCATCCCCAGCTGGATGGCAAAATTCTTTTCTTGGACACTTGAACCCATCTTCTCTTCTTCAGAACCCACCAGCGAAGCCAGAATTGGGATGGGAGCCACGCTGGACATCCAGAGACAGCAGAGAATGGAGCTGCTGGACCGGCAGCTGATGTTCTCTCAGTTTGCACAAGGGAGGCGACAGAGACAGCAGCAGGGAGGAATGATCAATTGGAATCGTCTTTTTCCTCCTTTACGTCAGCGACAAAACGTAAACTATCAGGGCGGTCGGCAGTCTGAGCCAGCAGCGCCCCCTCTAGAAGTTTCTGAGGAACAGGTCGCCCGGCTCATGGAGATGGGATTTTCCAGAGGTGATGCTTTGGAAGCCCTGAGAGCTTCAAACAATGACCTCAATGTCGCCACCAACTTCCTGCTGCAGCACTGA
Sequence Length
696
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,426 Da
NCBI Official Full Name
Homo sapiens UBA domain containing 2, mRNA
NCBI Official Synonym Full Names
UBA domain containing 2
NCBI Official Symbol
UBAC2
NCBI Official Synonym Symbols
PHGDHL1
NCBI Protein Information
ubiquitin-associated domain-containing protein 2
UniProt Protein Name
Ubiquitin-associated domain-containing protein 2
Protein Family
UniProt Gene Name
UBAC2
UniProt Synonym Gene Names
PHGDHL1; UBA domain-containing protein 2
UniProt Entry Name
UBAC2_HUMAN
Uniprot Description
UBAC2: 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 13q32.3
Cellular Component: endoplasmic reticulum
Molecular Function: protein binding
Research Articles on UBAC2
Similar Products
Product Notes
The UBAC2 ubac2 (Catalog #AAA1274691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCAGTATT TCTTTGGCAT CACTGCAGCT AGTAATTTGC CTTCTGGATT CCTGGCACCT GTGTTTGCTC TGTTTGTACC ATTTTACTGC TCCATACCAA GAGTCCAAGT GGCACAAATT CTGGGTCCGT TGTCCATCAC AAACAAGACA TTGATTTATA TATTGGGACT GCAGCTTTTC ACCTCTGGTT CCTACATCTG GATTGTAGCC ATAAGTGGAC TTATGTCCGG TCTGTGCTAC GACAGCAAAA TGTTCCAGGT GCATCAGGTG CTCTGCATCC CCAGCTGGAT GGCAAAATTC TTTTCTTGGA CACTTGAACC CATCTTCTCT TCTTCAGAAC CCACCAGCGA AGCCAGAATT GGGATGGGAG CCACGCTGGA CATCCAGAGA CAGCAGAGAA TGGAGCTGCT GGACCGGCAG CTGATGTTCT CTCAGTTTGC ACAAGGGAGG CGACAGAGAC AGCAGCAGGG AGGAATGATC AATTGGAATC GTCTTTTTCC TCCTTTACGT CAGCGACAAA ACGTAAACTA TCAGGGCGGT CGGCAGTCTG AGCCAGCAGC GCCCCCTCTA GAAGTTTCTG AGGAACAGGT CGCCCGGCTC ATGGAGATGG GATTTTCCAG AGGTGATGCT TTGGAAGCCC TGAGAGCTTC AAACAATGAC CTCAATGTCG CCACCAACTT CCTGCTGCAG CACTGA. It is sometimes possible for the material contained within the vial of "UBAC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
