Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TUBB cdna clone

TUBB cDNA Clone

Gene Names
TUBB; M40; TUBB1; TUBB5; CDCBM6; CSCSC1; OK/SW-cl.56
Synonyms
TUBB; TUBB cDNA Clone; TUBB cdna clone
Ordering
For Research Use Only!
Sequence
atgtccatgaaggaggtcgatgagcagatgcttaacgtgcagaacaagaacagcagctactttgtggaatggatccccaacaatgtcaagacagccgtctgtgacatcccacctcgtggcctcaagatggcagtcaccttcattggcaatagcacagccatccaggagctcttcaagcgcatctcggagcagttcactgccatgttccgccggaaggccttcctccactggtacacaggcgagggcatggacgagatggagttcaccgaggctgagagcaacatgaacgacctcgtctctgagtatcagcagtaccaggatgccaccgcagaagaggaggaggatttcggtgaggaggccgaagaggaggcctaa
Sequence Length
375
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,671 Da
NCBI Official Full Name
Homo sapiens tubulin, beta, mRNA
NCBI Official Synonym Full Names
tubulin beta class I
NCBI Official Symbol
TUBB
NCBI Official Synonym Symbols
M40; TUBB1; TUBB5; CDCBM6; CSCSC1; OK/SW-cl.56
NCBI Protein Information
tubulin beta chain
UniProt Protein Name
Tubulin beta chain
Protein Family
UniProt Gene Name
TUBB
UniProt Synonym Gene Names
TUBB5
UniProt Entry Name
TBB5_HUMAN

NCBI Description

This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13. [provided by RefSeq, Jun 2014]

Uniprot Description

TUBB: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha-chain. Dimer of alpha and beta chains. May interact with RNABP10. Interacts with PIFO/C1orf88. Ubiquitously expressed with highest levels in spleen, thymus and immature brain. Belongs to the tubulin family.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal

Chromosomal Location of Human Ortholog: 6p21.33

Cellular Component: cytoskeleton; extracellular matrix; extracellular region; microtubule; nuclear envelope lumen; nucleus

Molecular Function: MHC class I protein binding; protein binding; structural molecule activity; ubiquitin protein ligase binding

Biological Process: cell division; cell motility; cellular process; cytoskeleton-dependent intracellular transport; G2/M transition of mitotic cell cycle; microtubule-based process

Disease: Cortical Dysplasia, Complex, With Other Brain Malformations 6; Skin Creases, Congenital Symmetric Circumferential, 1

Research Articles on TUBB

Similar Products

Product Notes

The TUBB tubb (Catalog #AAA1276978) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccatga aggaggtcga tgagcagatg cttaacgtgc agaacaagaa cagcagctac tttgtggaat ggatccccaa caatgtcaag acagccgtct gtgacatccc acctcgtggc ctcaagatgg cagtcacctt cattggcaat agcacagcca tccaggagct cttcaagcgc atctcggagc agttcactgc catgttccgc cggaaggcct tcctccactg gtacacaggc gagggcatgg acgagatgga gttcaccgag gctgagagca acatgaacga cctcgtctct gagtatcagc agtaccagga tgccaccgca gaagaggagg aggatttcgg tgaggaggcc gaagaggagg cctaa. It is sometimes possible for the material contained within the vial of "TUBB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.