Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTYH1 cdna clone

TTYH1 cDNA Clone

Synonyms
TTYH1; TTYH1 cDNA Clone; TTYH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggctggcctacgtcctcctgctgctcctggagctgctggtctgcctcttcaccctcctgggcctggcgaagcagagcaagtggctggtgatcgtgatgacagtcatgagtctcctggttctcgtcctgagctggggctccatgggcctggaggcagccacggccgtgggcctcagtgacttctgctccaatccagacccttatgttctgaacctgacccaggaggagacagggctcagctcagacatcctgagctattatctcctctgcaaccgggccgtctccaaccccttccaacagaggctgactctgtcccagcgagctctggccaacatccactcccagctgctgggcctggagcgagaagctgtgcctcagttcccttcagcgcagaagcctctgctgtccttggaggagactctgaatgtgacagaaggaaatttccaccagttggtggcactgctacactgccgcagcctgcacaaggactatggtgcagccctgcggggcctgtgcgaagacgccctggaaggcctgctcttcctgctgctcttctccctgctgtctgcaggagcgctggccactgccctctgcagcctgccccgagcctgggccctcttcccacccagtgacgactacgatgacacagacgatgacgaccctttcaaccctcagcaggaatccaagcgctttgtgcagtggcagtcgtctatctga
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,119 Da
NCBI Official Full Name
Homo sapiens tweety homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
tweety family member 1
NCBI Official Symbol
TTYH1
NCBI Protein Information
protein tweety homolog 1
UniProt Protein Name
Protein tweety homolog 1
Protein Family
UniProt Gene Name
TTYH1
UniProt Synonym Gene Names
hTTY1
UniProt Entry Name
TTYH1_HUMAN

NCBI Description

This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-independent, volume-sensitive large conductance chloride(-) channel. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

TTYH1: Probable chloride channel. May be involved in cell adhesion. Belongs to the tweety family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, ion channel; Transporter; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: integral to membrane; plasma membrane

Molecular Function: chloride channel activity

Biological Process: chloride transport

Research Articles on TTYH1

Similar Products

Product Notes

The TTYH1 ttyh1 (Catalog #AAA1266862) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctgg cctacgtcct cctgctgctc ctggagctgc tggtctgcct cttcaccctc ctgggcctgg cgaagcagag caagtggctg gtgatcgtga tgacagtcat gagtctcctg gttctcgtcc tgagctgggg ctccatgggc ctggaggcag ccacggccgt gggcctcagt gacttctgct ccaatccaga cccttatgtt ctgaacctga cccaggagga gacagggctc agctcagaca tcctgagcta ttatctcctc tgcaaccggg ccgtctccaa ccccttccaa cagaggctga ctctgtccca gcgagctctg gccaacatcc actcccagct gctgggcctg gagcgagaag ctgtgcctca gttcccttca gcgcagaagc ctctgctgtc cttggaggag actctgaatg tgacagaagg aaatttccac cagttggtgg cactgctaca ctgccgcagc ctgcacaagg actatggtgc agccctgcgg ggcctgtgcg aagacgccct ggaaggcctg ctcttcctgc tgctcttctc cctgctgtct gcaggagcgc tggccactgc cctctgcagc ctgccccgag cctgggccct cttcccaccc agtgacgact acgatgacac agacgatgac gaccctttca accctcagca ggaatccaag cgctttgtgc agtggcagtc gtctatctga. It is sometimes possible for the material contained within the vial of "TTYH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.