Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTLL6 cdna clone

TTLL6 cDNA Clone

Gene Names
TTLL6; TTL.6
Synonyms
TTLL6; TTLL6 cDNA Clone; TTLL6 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggggtgtctcggggtagcagtactaaggaagctctccaccttcagtgcatacttggaggaccacagctacaacgtggagcagatatggagggatattgaggacgtcatcatcaagaccctcatctcggcccaccccatcatcaggcataactaccacacctgcttccccaaccacacactcaacagcgcctgctttgagatcctgggctttgacattttgttggaccacaaactcaaaccctggctgctggaggtcaaccactctccaagcttctccaccgactctcggttggataaagaggtgaaagatggtctgctgtatgacaccttagtcctgatcaacctggaaagctgtgacaagaagaaagtcttggaggaggagagacaacgggggcagttcctgcagcagtgttgttctcgggagatgaggattgaggaagccaagggtttccgggccgtgcagttaaagaaaactgaaacgtatgagaaggaaaactgtggagggttccgactgatttatcccagtctgaattcggagaagtatgagaagtttttccaggacaacaactccctcttccagaatactgttgcttccagggctcgggaggagtatgcccggcaactgatccaggagctgagactaaaacgggagaaaaagcccttccaaatgaagaagaaggtagagatgcagggggaatcggcaggcgagcaagtgagaaagaagggcatgaggggctggcaacagaaacaacagcagaaagacaaggccgccacccaagcctccaaacagtacatccagccattgacattagtatcctacacacctgacttgctcttgagtgtcagaggtgaaaggaaaaatgaaacagacagcagcctcaaccaggaggctcccacggaggaggccagctctgttttccccaagctgacgtctgcgaagcccttcagttctctacccgatctgaggaatatcaatctcagcagctcgaagttggagcccagtaaacccaacttcagcatcaaggaggccaagtctgcctctgcagtgaacgtattcactggcactgtgcacttaacctccgtagaaaccaccccagaatccaccacccaactctcaatctccccaaagtctccgccaaccctggctgtgaccgccagctctgagtacagtggcccagagacggacagggtggtatcctttaaatgcaagaagcagcagacccctccacacttaacccagaagaaaatgttaaaatcttttctgcccacaaaatccaagagcttctgggagagtccgaacacaaactggactttgctaaagagtgacatgaacaagccacatttgatatccgagctactcaccaagcttcaactgagtgggaagctctccttcttcccagctcactacaaccccaagctggggatgaataacctgtcacaaaacccctccctgcctggggagtgccactcccgcagtgacagctctggcgagaagaggcagctggatgtgtcctccctcctcttgcagagtcctcagagctataatgttactctgagggacctgctggtgattgccactccagcccaactggatccaaggccttgtagaagccacgcaagtgctatgagggacccatgtatgcaggatcaagaagcatacagccattgcctgatctctggccaaaaaggatgtgagaggagctag
Sequence Length
1710
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,547 Da
NCBI Official Full Name
Homo sapiens tubulin tyrosine ligase-like family, member 6, mRNA
NCBI Official Synonym Full Names
tubulin tyrosine ligase like 6
NCBI Official Symbol
TTLL6
NCBI Official Synonym Symbols
TTL.6
NCBI Protein Information
tubulin polyglutamylase TTLL6
UniProt Protein Name
Tubulin polyglutamylase TTLL6
Protein Family
UniProt Gene Name
TTLL6
UniProt Entry Name
TTLL6_HUMAN

Uniprot Description

TTLL6: Polyglutamylase which preferentially modifies alpha- tubulin. Mediates tubulin polyglutamylation in cilia. Involved in the side-chain elongation step of the polyglutamylation reaction rather than in the initiation step. Belongs to the tubulin--tyrosine ligase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.-.-.-; Ligase

Chromosomal Location of Human Ortholog: 17q21.32

Molecular Function: protein binding; tubulin binding

Biological Process: protein polyglutamylation

Similar Products

Product Notes

The TTLL6 ttll6 (Catalog #AAA1275084) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggggt gtctcggggt agcagtacta aggaagctct ccaccttcag tgcatacttg gaggaccaca gctacaacgt ggagcagata tggagggata ttgaggacgt catcatcaag accctcatct cggcccaccc catcatcagg cataactacc acacctgctt ccccaaccac acactcaaca gcgcctgctt tgagatcctg ggctttgaca ttttgttgga ccacaaactc aaaccctggc tgctggaggt caaccactct ccaagcttct ccaccgactc tcggttggat aaagaggtga aagatggtct gctgtatgac accttagtcc tgatcaacct ggaaagctgt gacaagaaga aagtcttgga ggaggagaga caacgggggc agttcctgca gcagtgttgt tctcgggaga tgaggattga ggaagccaag ggtttccggg ccgtgcagtt aaagaaaact gaaacgtatg agaaggaaaa ctgtggaggg ttccgactga tttatcccag tctgaattcg gagaagtatg agaagttttt ccaggacaac aactccctct tccagaatac tgttgcttcc agggctcggg aggagtatgc ccggcaactg atccaggagc tgagactaaa acgggagaaa aagcccttcc aaatgaagaa gaaggtagag atgcaggggg aatcggcagg cgagcaagtg agaaagaagg gcatgagggg ctggcaacag aaacaacagc agaaagacaa ggccgccacc caagcctcca aacagtacat ccagccattg acattagtat cctacacacc tgacttgctc ttgagtgtca gaggtgaaag gaaaaatgaa acagacagca gcctcaacca ggaggctccc acggaggagg ccagctctgt tttccccaag ctgacgtctg cgaagccctt cagttctcta cccgatctga ggaatatcaa tctcagcagc tcgaagttgg agcccagtaa acccaacttc agcatcaagg aggccaagtc tgcctctgca gtgaacgtat tcactggcac tgtgcactta acctccgtag aaaccacccc agaatccacc acccaactct caatctcccc aaagtctccg ccaaccctgg ctgtgaccgc cagctctgag tacagtggcc cagagacgga cagggtggta tcctttaaat gcaagaagca gcagacccct ccacacttaa cccagaagaa aatgttaaaa tcttttctgc ccacaaaatc caagagcttc tgggagagtc cgaacacaaa ctggactttg ctaaagagtg acatgaacaa gccacatttg atatccgagc tactcaccaa gcttcaactg agtgggaagc tctccttctt cccagctcac tacaacccca agctggggat gaataacctg tcacaaaacc cctccctgcc tggggagtgc cactcccgca gtgacagctc tggcgagaag aggcagctgg atgtgtcctc cctcctcttg cagagtcctc agagctataa tgttactctg agggacctgc tggtgattgc cactccagcc caactggatc caaggccttg tagaagccac gcaagtgcta tgagggaccc atgtatgcag gatcaagaag catacagcca ttgcctgatc tctggccaaa aaggatgtga gaggagctag. It is sometimes possible for the material contained within the vial of "TTLL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.