TTC1 cdna clone
TTC1 cDNA Clone
Gene Names
TTC1; TPR1
Synonyms
TTC1; TTC1 cDNA Clone; TTC1 cdna clone
Sequence
atgggggagaagtcagagaactgtggggttccagaggatctgttaaatggtttgaaggttacagatactcaggaagccgagtgtgctggccctccagttcctgatcccaaaaatcagcattcccagagtaagctgctcagggatgatgaggcccatctccaggaggaccagggagaagaggagtgttttcatgactgcagtgcctcatttgaggaggagccaggagcggacaaggttgagaacaaatctaatgaagatgtgaattcctctgaactagatgaagaatacctaatagaactgaaaaaaaacatgtcggatgaagagaaacagaaaagaagagaagagagcactagactaaaggaggagggaaatgaacagtttaagaaaggagattatatagaagctgaaagttcttatagtcgagccctcgaaatgtgcccatcctgcttccaaaaggagaggtcgattctattttcaaatagagctgcagcaaggatgaaacaggacaagaaagaaatggccatcaatgactgcagcaaagcaattcaattaaaccccagctatatcagggcaatattgaggagagcagagttgtatgagaagacggacaagctagatgaagccctggaagactataaatctatattagaaaaagatccatcaatacatcaagcaagagaagcttgtatgagattacctaagcaaattgaagaacgtaatgaaagactaaaagaagagatgttaggtaaattaaaagatcttgggaacttggttctccgaccttttgggctctccacggaaaatttccagatcaaacaggattcctctaccggctcgtactccatcaatttcgttcaaaatccaaataataacagataa
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,526 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 1, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 1
NCBI Official Symbol
TTC1
NCBI Official Synonym Symbols
TPR1
NCBI Protein Information
tetratricopeptide repeat protein 1
UniProt Protein Name
Tetratricopeptide repeat protein 1
UniProt Gene Name
TTC1
UniProt Synonym Gene Names
TPR1; TPR repeat protein 1
UniProt Entry Name
TTC1_HUMAN
NCBI Description
This gene encodes a protein that belongs to the tetratrico peptide repeat superfamily of proteins. The encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Uniprot Description
TTC1: Interacts with the GAP domain of NF1.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 5q33.3
Cellular Component: cytoplasm; peroxisomal membrane
Molecular Function: protein binding
Research Articles on TTC1
Similar Products
Product Notes
The TTC1 ttc1 (Catalog #AAA1268623) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaga agtcagagaa ctgtggggtt ccagaggatc tgttaaatgg tttgaaggtt acagatactc aggaagccga gtgtgctggc cctccagttc ctgatcccaa aaatcagcat tcccagagta agctgctcag ggatgatgag gcccatctcc aggaggacca gggagaagag gagtgttttc atgactgcag tgcctcattt gaggaggagc caggagcgga caaggttgag aacaaatcta atgaagatgt gaattcctct gaactagatg aagaatacct aatagaactg aaaaaaaaca tgtcggatga agagaaacag aaaagaagag aagagagcac tagactaaag gaggagggaa atgaacagtt taagaaagga gattatatag aagctgaaag ttcttatagt cgagccctcg aaatgtgccc atcctgcttc caaaaggaga ggtcgattct attttcaaat agagctgcag caaggatgaa acaggacaag aaagaaatgg ccatcaatga ctgcagcaaa gcaattcaat taaaccccag ctatatcagg gcaatattga ggagagcaga gttgtatgag aagacggaca agctagatga agccctggaa gactataaat ctatattaga aaaagatcca tcaatacatc aagcaagaga agcttgtatg agattaccta agcaaattga agaacgtaat gaaagactaa aagaagagat gttaggtaaa ttaaaagatc ttgggaactt ggttctccga ccttttgggc tctccacgga aaatttccag atcaaacagg attcctctac cggctcgtac tccatcaatt tcgttcaaaa tccaaataat aacagataa. It is sometimes possible for the material contained within the vial of "TTC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
