Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSG101 cdna clone

TSG101 cDNA Clone

Gene Names
TSG101; TSG10; VPS23
Synonyms
TSG101; TSG101 cDNA Clone; TSG101 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgtcggagagccagctcaagaaaatggtgtccaagtacaaatacagagacctaactgtacgtgaaactgtcaatgttattactctatacaaagatctcaaacctgttttggattcatatgtttttaacgatggcagttccagggaactaatgaacctcactggaacaatccctgtgccttatagaggtaatacatacaatattccaatatgcctatggctactggacacatacccatataatccccctatctgttttgttaagcctactagttcaatgactattaaaacaggaaagcatgttgatgcaaatgggaagatatatcttccttatctacatgaatggaaacacccacagtcagacttgttggggcttattcaggtcatgattgtggtatttggagatgaacctccagtcttctctcgtcctatttcggcatcctatccgccataccaggcaacggggccaccaaatacttcctacatgccaggcatgccaggtggaatctctccatacccatccggataccctcccaatcccagtggttacccaggctgtccttacccacctggtggtccatatcctgccacaacaagttctcagtacccttctcagcctcctgtgaccactgttggtcccagtagggatggcacaatcagcgaggacaccatccgagcctctctcatctctgcggtcagtgacaaactgagatggcggatgaaggaggaaatggatcgtgcccaggcagagctcaatgccttgaaacgaacagaagaagacctgaaaaagggtcaccagaaactggaagagatggttacccgtttagatcaagaagtagccgaggttgataaaaacatagaacttttgaaaaagaaggatgaagaactcagttctgctctggaaaaaatggaaaatcagtctgaaaacaatgatatcgatgaagttatcattcccacagctcccttatacaaacagatcctgaatctgtatgcagaagaaaacgctattgaagacactatcctttacttgggagaagccttgagaaggggcgtgatagacctggatgtcttcctgaagcatgtacgtcttctgtcccgtaaacagttccagctgagggcactaatgcaaaaagcaagaaagactgccggtctcagtgacctctactga
Sequence Length
1173
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,732 Da
NCBI Official Full Name
Homo sapiens tumor susceptibility gene 101, mRNA
NCBI Official Synonym Full Names
tumor susceptibility 101
NCBI Official Symbol
TSG101
NCBI Official Synonym Symbols
TSG10; VPS23
NCBI Protein Information
tumor susceptibility gene 101 protein
UniProt Protein Name
Tumor susceptibility gene 101 protein
UniProt Gene Name
TSG101
UniProt Entry Name
TS101_HUMAN

NCBI Description

The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]

Uniprot Description

TSG101: Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Binds to ubiquitinated cargo proteins and is required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies (MVBs). Mediates the association between the ESCRT-0 and ESCRT-I complex. Required for completion of cytokinesis; the function requires CEP55. May be involved in cell growth and differentiation. Acts as a negative growth regulator. Involved in the budding of many viruses through an interaction with viral proteins that contain a late-budding motif P-[ST]-A-P. This interaction is essential for viral particle budding of numerous retroviruses. Belongs to the ubiquitin-conjugating enzyme family. UEV subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Cell cycle regulation

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: cytoplasm; early endosome; endosome; endosome membrane; late endosome; multivesicular body; nucleolus; plasma membrane

Molecular Function: calcium-dependent protein binding; DNA binding; protein binding; protein homodimerization activity; ubiquitin binding; ubiquitin protein ligase binding; virion binding

Biological Process: autophagy; endosome transport; non-lytic virus budding; positive regulation of viral reproduction; regulation of MAP kinase activity; ubiquitin-dependent protein catabolic process via the multivesicular body pathway; viral infectious cycle

Disease: Breast Cancer

Research Articles on TSG101

Similar Products

Product Notes

The TSG101 tsg101 (Catalog #AAA1271862) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgt cggagagcca gctcaagaaa atggtgtcca agtacaaata cagagaccta actgtacgtg aaactgtcaa tgttattact ctatacaaag atctcaaacc tgttttggat tcatatgttt ttaacgatgg cagttccagg gaactaatga acctcactgg aacaatccct gtgccttata gaggtaatac atacaatatt ccaatatgcc tatggctact ggacacatac ccatataatc cccctatctg ttttgttaag cctactagtt caatgactat taaaacagga aagcatgttg atgcaaatgg gaagatatat cttccttatc tacatgaatg gaaacaccca cagtcagact tgttggggct tattcaggtc atgattgtgg tatttggaga tgaacctcca gtcttctctc gtcctatttc ggcatcctat ccgccatacc aggcaacggg gccaccaaat acttcctaca tgccaggcat gccaggtgga atctctccat acccatccgg ataccctccc aatcccagtg gttacccagg ctgtccttac ccacctggtg gtccatatcc tgccacaaca agttctcagt acccttctca gcctcctgtg accactgttg gtcccagtag ggatggcaca atcagcgagg acaccatccg agcctctctc atctctgcgg tcagtgacaa actgagatgg cggatgaagg aggaaatgga tcgtgcccag gcagagctca atgccttgaa acgaacagaa gaagacctga aaaagggtca ccagaaactg gaagagatgg ttacccgttt agatcaagaa gtagccgagg ttgataaaaa catagaactt ttgaaaaaga aggatgaaga actcagttct gctctggaaa aaatggaaaa tcagtctgaa aacaatgata tcgatgaagt tatcattccc acagctccct tatacaaaca gatcctgaat ctgtatgcag aagaaaacgc tattgaagac actatccttt acttgggaga agccttgaga aggggcgtga tagacctgga tgtcttcctg aagcatgtac gtcttctgtc ccgtaaacag ttccagctga gggcactaat gcaaaaagca agaaagactg ccggtctcag tgacctctac tga. It is sometimes possible for the material contained within the vial of "TSG101, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.