Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRPV2 cdna clone

TRPV2 cDNA Clone

Gene Names
TRPV2; VRL; VRL1; VRL-1
Synonyms
TRPV2; TRPV2 cDNA Clone; TRPV2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacctcaccctccagctctccagttttcaggttggagacattagatggaggccaagaagatggctctgaggcggacagaggaaagctggattttgggagcgggctgcctcccatggagtcacagttccagggcgaggaccggaaattcgcccctcagataagagtcaacctcaactaccgaaagggaacaggtgccagtcagccggatccaaaccgatttgaccgagatcggctcttcaatgcggtctcccggggtgtccccgaggatctggctggacttccagagtacctgagcaagaccagcaagtacctcaccgactcggaatacacagagggctccacaggtaagacgtgcctgatgaaggctgtgctgaaccttaaggacggagtcaatgcctgcattctgccactgctgcagatcgacagggactctggcaatcctcagcccctggtaaatgcccagtgcacagatgactattaccgaggccacagcgctctgcacatcgccattgagaagaggagtctgcagtgtgtgaagctcctggtggagaatggggccaatgtgcatgcccgggcctgcggccgcttcttccagaagggccaagggacttgcttttatttcggtgagctacccctctctttggccgcttgcaccaagcagtgggatgtggtaagctacctcctggagaacccacaccagcccgccagcctgcaggccactgactcccagggcaacacagtcctgcatgccctagtgatgatctcggacaactcagctgagaacattgcactggtgaccagcatgtatgatgggctcctccaagctggggcccgcctctgccctaccgtgcagcttgaggacatccgcaacctgcaggatctcacgcctctgaagctggccgccaaggagggcaagatcgagattttcaggcacatcctgcagcgggagttttcaggactgagccacctttcccgaaagttcaccgagtggtgctatgggcctgtccgggtgtcgctgtatgacctggcttctgtggacagctgtgaggagaactcagtgctggagatcattgcctttcattgcaagagcccgcaccgacaccgaatggtcgttttggagcccctgaacaaactgctgcaggcgaaatgggatctgctcatccccaagttcttcttaaacttcctgtgtaatctgatctacatgttcatcttcaccgctgttgcctaccatcagcctaccctgaagaagcaggccgcccctcacctgaaagcggaggttggaaactccatgctgctgacgggccacatccttatcctgctaggggggatctacctcctcgtgggccagctgtggtacttctggcggcgccacgtgttcatctggatctcgttcatagacagctactttgaaatcctcttcctgttccaggccctgctcacagtggtgtcccaggtgctgtgtttcctggccatcgagtggtacctgcccctgcttgtgtctgcgctggtgctgggctggctgaacctgctttactatacacgtggcttccagcacacaggcatctacagtgtcatgatccagaaggtcatcctgcgggacctgctgcgcttccttctgatctacttagtcttccttttcggcttcgctgtagccctggtgagcctgagccaggaggcttggcgccccgaagctcctacaggccccaatgccacagagtcagtgcagcccatggagggacaggaggacgagggcaacggggcccagtacaggggtatcctggaagcctccttggagctcttcaaattcaccatcggcatgggcgagctggccttccaggagcagctgcacttccgcggcatggtgctgctgctgctgctggcctacgtgctgctcacctacatcctgctgctcaacatgctcatcgccctcatgagcgagaccgtcaacagtgtcgccactgacagctggagcatctggaagctgcagaaagccatctctgtcctggagatggagaatggctattggtggtgcaggaagaagcagcgggcaggtgtgatgctgaccgttggcactaagccagatggcagccccgatgagcgctggtgcttcagggtggaggaggtgaactgggcttcatgggagcagacgctgcctacgctgtgtgaggacccgtcaggggcaggtgtccctcgaactctcgagaaccctgtcctggcttcccctcccaaggaggatgaggatggtgcctctgaggaaaactatgtgcccgtccagctcctccagtccaactga
Sequence Length
2295
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,981 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily V, member 2, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily V member 2
NCBI Official Symbol
TRPV2
NCBI Official Synonym Symbols
VRL; VRL1; VRL-1
NCBI Protein Information
transient receptor potential cation channel subfamily V member 2
UniProt Protein Name
Transient receptor potential cation channel subfamily V member 2
UniProt Gene Name
TRPV2
UniProt Synonym Gene Names
VRL; TrpV2; OTRPC2; VRL-1
UniProt Entry Name
TRPV2_HUMAN

NCBI Description

This gene encodes an ion channel that is activated by high temperatures above 52 degrees Celsius. The protein may be involved in transduction of high-temperature heat responses in sensory ganglia. It is thought that in other tissues the channel may be activated by stimuli other than heat. [provided by RefSeq, Jul 2008]

Uniprot Description

TRPV2: Calcium-permeable, non-selective cation channel with an outward rectification. Seems to be regulated, at least in part, by IGF-I, PDGF and neuropeptide head activator. May transduce physical stimuli in mast cells. Activated by temperatures higher than 52 degrees Celsius; is not activated by vanilloids and acidic pH. Belongs to the transient receptor (TC 1.A.4) family. TrpV subfamily. TRPV2 sub-subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, cation

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: calcium channel activity; cation channel activity; ion channel activity; ion transmembrane transporter activity

Biological Process: response to temperature stimulus; sensory perception; transport

Research Articles on TRPV2

Similar Products

Product Notes

The TRPV2 trpv2 (Catalog #AAA1273552) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcac cctccagctc tccagttttc aggttggaga cattagatgg aggccaagaa gatggctctg aggcggacag aggaaagctg gattttggga gcgggctgcc tcccatggag tcacagttcc agggcgagga ccggaaattc gcccctcaga taagagtcaa cctcaactac cgaaagggaa caggtgccag tcagccggat ccaaaccgat ttgaccgaga tcggctcttc aatgcggtct cccggggtgt ccccgaggat ctggctggac ttccagagta cctgagcaag accagcaagt acctcaccga ctcggaatac acagagggct ccacaggtaa gacgtgcctg atgaaggctg tgctgaacct taaggacgga gtcaatgcct gcattctgcc actgctgcag atcgacaggg actctggcaa tcctcagccc ctggtaaatg cccagtgcac agatgactat taccgaggcc acagcgctct gcacatcgcc attgagaaga ggagtctgca gtgtgtgaag ctcctggtgg agaatggggc caatgtgcat gcccgggcct gcggccgctt cttccagaag ggccaaggga cttgctttta tttcggtgag ctacccctct ctttggccgc ttgcaccaag cagtgggatg tggtaagcta cctcctggag aacccacacc agcccgccag cctgcaggcc actgactccc agggcaacac agtcctgcat gccctagtga tgatctcgga caactcagct gagaacattg cactggtgac cagcatgtat gatgggctcc tccaagctgg ggcccgcctc tgccctaccg tgcagcttga ggacatccgc aacctgcagg atctcacgcc tctgaagctg gccgccaagg agggcaagat cgagattttc aggcacatcc tgcagcggga gttttcagga ctgagccacc tttcccgaaa gttcaccgag tggtgctatg ggcctgtccg ggtgtcgctg tatgacctgg cttctgtgga cagctgtgag gagaactcag tgctggagat cattgccttt cattgcaaga gcccgcaccg acaccgaatg gtcgttttgg agcccctgaa caaactgctg caggcgaaat gggatctgct catccccaag ttcttcttaa acttcctgtg taatctgatc tacatgttca tcttcaccgc tgttgcctac catcagccta ccctgaagaa gcaggccgcc cctcacctga aagcggaggt tggaaactcc atgctgctga cgggccacat ccttatcctg ctagggggga tctacctcct cgtgggccag ctgtggtact tctggcggcg ccacgtgttc atctggatct cgttcataga cagctacttt gaaatcctct tcctgttcca ggccctgctc acagtggtgt cccaggtgct gtgtttcctg gccatcgagt ggtacctgcc cctgcttgtg tctgcgctgg tgctgggctg gctgaacctg ctttactata cacgtggctt ccagcacaca ggcatctaca gtgtcatgat ccagaaggtc atcctgcggg acctgctgcg cttccttctg atctacttag tcttcctttt cggcttcgct gtagccctgg tgagcctgag ccaggaggct tggcgccccg aagctcctac aggccccaat gccacagagt cagtgcagcc catggaggga caggaggacg agggcaacgg ggcccagtac aggggtatcc tggaagcctc cttggagctc ttcaaattca ccatcggcat gggcgagctg gccttccagg agcagctgca cttccgcggc atggtgctgc tgctgctgct ggcctacgtg ctgctcacct acatcctgct gctcaacatg ctcatcgccc tcatgagcga gaccgtcaac agtgtcgcca ctgacagctg gagcatctgg aagctgcaga aagccatctc tgtcctggag atggagaatg gctattggtg gtgcaggaag aagcagcggg caggtgtgat gctgaccgtt ggcactaagc cagatggcag ccccgatgag cgctggtgct tcagggtgga ggaggtgaac tgggcttcat gggagcagac gctgcctacg ctgtgtgagg acccgtcagg ggcaggtgtc cctcgaactc tcgagaaccc tgtcctggct tcccctccca aggaggatga ggatggtgcc tctgaggaaa actatgtgcc cgtccagctc ctccagtcca actga. It is sometimes possible for the material contained within the vial of "TRPV2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.