Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM9 cdna clone

TRIM9 cDNA Clone

Gene Names
TRIM9; RNF91; SPRING
Synonyms
TRIM9; TRIM9 cDNA Clone; TRIM9 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagatggaagaggagttgaaatgccccgtgtgcggctccttctatcgggagcccatcatcctgccctgctctcacaatttgtgtcaggcgtgcgcccgcaacatcctggtgcagaccccagagtctgaatccccccagagccatcgggccgcgggctccggggtctccgactatgactatctggacctggacaagatgagcctatacagcgaggcggacagcggctatggctcctacggggggttcgccagcgcccccactaccccgtgccagaagtcccccaacggcgtccgcgtgtttcccccggctatgccgccaccggccacccacttgtcaccggccctggccccggtgccccgcaactcctgtatcacctgcccccagtgtcaccgcagcctcatcctggatgaccgggggctccgcggcttccccaagaatcgcgtactggaaggggtaattgaccgctaccagcagagcaaagccgcggccctcaagtgccagctctgcgagaaggcgcccaaggaagccaccgtcatgtgcgaacagtgcgatgtcttctactgcgatccgtgccgcctgcgctgccacccgccccgggggcccctagccaagcaccgcctggtgcccccggcccagggtcgtgtgagccggaggctgagcccacgcaaggtctccacctgcacagaccacgagctggagaaccacagcatgtactgcgtgcaatgcaagatgcccgtgtgctaccagtgcttggaggagggcaaacactccagccacgaagtcaaggctctgggggccatgtggaaactacataagagccagctctcccaggcgctgaacggactgtcagacagggccaaagaagccaaggagtttctggtacagctgcgcaacatggtccagcagatccaggagaacagtgtggagtttgaagcctgtctggtggcccaatgtgatgccctcatcgatgccctcaacagaagaaaagcccagctgctggcccgcgtcaacaaggagcatgagcacaagctgaaggtggttcgagatcagatctctcactgcacagtgaaattgcgccagaccacaggtctcatggagtactgcttggaggtgattaaggaaaatgatcctagtggttttttgcagatttctgacgccctcataagaagagtgcacctgactgaggatcagtggggtaaaggcacactcactccaaggatgaccacggactttgacttgagtctggacaacagccctctgctgcaatccatccaccagctggatttcgtgcaagtgaaagcttcctctccagtcccagcaacccctatcctacagctggaggaatgttgtacccacaacaacagcgctacgttgtcctggaaacagccacctctgtccacggtgcccgccgatggatacattctggagctggatgatggcaacggtggtcaattccgggaggtgtatgtggggaaggagacaatgtgcactgtggatggtcttcacttcaacagcacatacaacgctcgggtcaaggccttcaacaaaacaggagtcagcccgtacagcaagaccctggtcctccaaacgtctgaggtggcctggtttgctttcgaccctggctcggcgcactcggacatcatcctctccaatgacaacctgacagtgacctgtagtagctatgatgaccgggtggtgctagggaagactggcttctccaagggcatccactactgggagctcacggtagatcgctatgacaaccaccctgatcctgcctttggtgtggctcgcatggacgtgatgaaggatgtgatgttaggaaaagacgacaaagcttgggcaatgtatgtggacaataaccggagctggttcatgcacaacaactcgcacaccaacagaactgagggagggatcacaaaaggggccacaattggggtcctcctcgacttcaatagaaaaaacttgacattttttatcaacgatgaacaacaaggtcccatagcatttgataacgtggagggcctcttcttccctgcggtcagcctgaacaggaacgtgcaggtcacgctgcacaccgggctcccagtccccgacttctactccagcagagcatcaatagcctaa
Sequence Length
2133
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,346 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 9, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 9
NCBI Official Symbol
TRIM9
NCBI Official Synonym Symbols
RNF91; SPRING
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM9
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM9
UniProt Gene Name
TRIM9
UniProt Synonym Gene Names
KIAA0282; RNF91
UniProt Entry Name
TRIM9_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM9: E3 ubiquitin-protein ligase which ubiquitinates itself in cooperation with an E2 enzyme UBE2D2/UBC4 and serves as a targeting signal for proteasomal degradation. May play a role in regulation of neuronal functions and may also participate in the formation or breakdown of abnormal inclusions in neurodegenerative disorders. May act as a regulator of synaptic vesicle exocytosis by controlling the availability of SNAP25 for the SNARE complex formation. Belongs to the TRIM/RBCC family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 14q22.1

Cellular Component: cytoplasm; dendrite

Molecular Function: protein binding; protein homodimerization activity; ubiquitin-protein ligase activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process

Research Articles on TRIM9

Similar Products

Product Notes

The TRIM9 trim9 (Catalog #AAA1271088) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaga tggaagagga gttgaaatgc cccgtgtgcg gctccttcta tcgggagccc atcatcctgc cctgctctca caatttgtgt caggcgtgcg cccgcaacat cctggtgcag accccagagt ctgaatcccc ccagagccat cgggccgcgg gctccggggt ctccgactat gactatctgg acctggacaa gatgagccta tacagcgagg cggacagcgg ctatggctcc tacggggggt tcgccagcgc ccccactacc ccgtgccaga agtcccccaa cggcgtccgc gtgtttcccc cggctatgcc gccaccggcc acccacttgt caccggccct ggccccggtg ccccgcaact cctgtatcac ctgcccccag tgtcaccgca gcctcatcct ggatgaccgg gggctccgcg gcttccccaa gaatcgcgta ctggaagggg taattgaccg ctaccagcag agcaaagccg cggccctcaa gtgccagctc tgcgagaagg cgcccaagga agccaccgtc atgtgcgaac agtgcgatgt cttctactgc gatccgtgcc gcctgcgctg ccacccgccc cgggggcccc tagccaagca ccgcctggtg cccccggccc agggtcgtgt gagccggagg ctgagcccac gcaaggtctc cacctgcaca gaccacgagc tggagaacca cagcatgtac tgcgtgcaat gcaagatgcc cgtgtgctac cagtgcttgg aggagggcaa acactccagc cacgaagtca aggctctggg ggccatgtgg aaactacata agagccagct ctcccaggcg ctgaacggac tgtcagacag ggccaaagaa gccaaggagt ttctggtaca gctgcgcaac atggtccagc agatccagga gaacagtgtg gagtttgaag cctgtctggt ggcccaatgt gatgccctca tcgatgccct caacagaaga aaagcccagc tgctggcccg cgtcaacaag gagcatgagc acaagctgaa ggtggttcga gatcagatct ctcactgcac agtgaaattg cgccagacca caggtctcat ggagtactgc ttggaggtga ttaaggaaaa tgatcctagt ggttttttgc agatttctga cgccctcata agaagagtgc acctgactga ggatcagtgg ggtaaaggca cactcactcc aaggatgacc acggactttg acttgagtct ggacaacagc cctctgctgc aatccatcca ccagctggat ttcgtgcaag tgaaagcttc ctctccagtc ccagcaaccc ctatcctaca gctggaggaa tgttgtaccc acaacaacag cgctacgttg tcctggaaac agccacctct gtccacggtg cccgccgatg gatacattct ggagctggat gatggcaacg gtggtcaatt ccgggaggtg tatgtgggga aggagacaat gtgcactgtg gatggtcttc acttcaacag cacatacaac gctcgggtca aggccttcaa caaaacagga gtcagcccgt acagcaagac cctggtcctc caaacgtctg aggtggcctg gtttgctttc gaccctggct cggcgcactc ggacatcatc ctctccaatg acaacctgac agtgacctgt agtagctatg atgaccgggt ggtgctaggg aagactggct tctccaaggg catccactac tgggagctca cggtagatcg ctatgacaac caccctgatc ctgcctttgg tgtggctcgc atggacgtga tgaaggatgt gatgttagga aaagacgaca aagcttgggc aatgtatgtg gacaataacc ggagctggtt catgcacaac aactcgcaca ccaacagaac tgagggaggg atcacaaaag gggccacaat tggggtcctc ctcgacttca atagaaaaaa cttgacattt tttatcaacg atgaacaaca aggtcccata gcatttgata acgtggaggg cctcttcttc cctgcggtca gcctgaacag gaacgtgcag gtcacgctgc acaccgggct cccagtcccc gacttctact ccagcagagc atcaatagcc taa. It is sometimes possible for the material contained within the vial of "TRIM9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.