TRIM17 cdna clone
TRIM17 cDNA Clone
Gene Names
TRIM17; RBCC; terf; RNF16
Synonyms
TRIM17; TRIM17 cDNA Clone; TRIM17 cdna clone
Sequence
atggaggctgtggaactcgccagaaaactgcaggaggaagctacgtgctccatctgtctggattacttcacagaccctgtgatgaccacctgtggccacaacttctgccgagcctgcatccagctgagctgggaaaaggcgaggggcaagaaggggaggcggaagcggaagggctccttcccctgccccgagtgcagagagatgtccccgcagaggaacctgctgcccaaccggctgctgaccaaggtggccgagatggcgcagcagcatcctggtctgcagaagcaagacctgtgccaggagcaccacgagcccctcaagcttttctgccagaaggaccagagccccatctgtgtggtgtgcagggagtcccgggagcaccggctgcacagggtgctgcccgccgaggaggcagtgcaggggtacaagttgaagctggaggaggacatggagtaccttcgggagcagatcaccaggacagggaatctgcaggccagggaggagcagagcttagccgagtggcagggcaaggtgaaggagcggagagaacgcattgtgctggagtttgagaagatgaacctctacctggtggaagaagagcagaggctcctccaggctctggagacggaagaagaggagactgccagcaggctccgggagagcgtggcctgcctggaccggcagggtcactctctggagctgctgctgctgcagctggaggagcggagcacacaggggcccctccagatgctgcaggacatgaaggaacccctgagcaggaagaacaacgtgagtgtgcagtgcccagaggttgcccccccaaccagacccaggactgtgtgcagagttcccggacagattgaagtgctaagaggctttctagaggatgtggtgcctgatgccacctccgcgtacccctacctcctcctgtatgagagccgccagaggcgctacctcggctcttcgccggagggcagtgggttctgcagcaaggaccgatttgtggcttacccctgtgctgtgggccagacggccttctcctctgggaggcactactgggaggtgggcatgaacatcaccggggacgcgttgtgggccctgggtgtgtgcagggacaacgtgagccggaaagacagggtccccaagtgccccgaaaacggcttctgggtggtgcagctgtccaaggggaccaagtacttatccaccttctctgccctaaccccggtcatgctgatggagcctcccagccacatgggcatcttcctggacttcgaagccggggaagtgtccttctacagtgtaagcgatgggtcccacctgcacacctactcccaggccaccttcccaggccccctgcagcctttcttctgcctgggggctccgaagtctggtcagatggtcatctccacagtgaccatgtgggtgaaaggatag
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,153 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 17, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 17
NCBI Official Symbol
TRIM17
NCBI Official Synonym Symbols
RBCC; terf; RNF16
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM17
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM17
Protein Family
UniProt Gene Name
TRIM17
UniProt Synonym Gene Names
RBCC; RNF16; TERF
UniProt Entry Name
TRI17_HUMAN
NCBI Description
The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
TRIM17: May function as an ubiquitin E3 ligase. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; EC 6.3.2.-
Chromosomal Location of Human Ortholog: 1q42
Molecular Function: protein binding; protein binding, bridging; ubiquitin-protein ligase activity
Biological Process: autophagy; protein autoubiquitination; regulation of protein localization
Research Articles on TRIM17
Similar Products
Product Notes
The TRIM17 trim17 (Catalog #AAA1270009) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggctg tggaactcgc cagaaaactg caggaggaag ctacgtgctc catctgtctg gattacttca cagaccctgt gatgaccacc tgtggccaca acttctgccg agcctgcatc cagctgagct gggaaaaggc gaggggcaag aaggggaggc ggaagcggaa gggctccttc ccctgccccg agtgcagaga gatgtccccg cagaggaacc tgctgcccaa ccggctgctg accaaggtgg ccgagatggc gcagcagcat cctggtctgc agaagcaaga cctgtgccag gagcaccacg agcccctcaa gcttttctgc cagaaggacc agagccccat ctgtgtggtg tgcagggagt cccgggagca ccggctgcac agggtgctgc ccgccgagga ggcagtgcag gggtacaagt tgaagctgga ggaggacatg gagtaccttc gggagcagat caccaggaca gggaatctgc aggccaggga ggagcagagc ttagccgagt ggcagggcaa ggtgaaggag cggagagaac gcattgtgct ggagtttgag aagatgaacc tctacctggt ggaagaagag cagaggctcc tccaggctct ggagacggaa gaagaggaga ctgccagcag gctccgggag agcgtggcct gcctggaccg gcagggtcac tctctggagc tgctgctgct gcagctggag gagcggagca cacaggggcc cctccagatg ctgcaggaca tgaaggaacc cctgagcagg aagaacaacg tgagtgtgca gtgcccagag gttgcccccc caaccagacc caggactgtg tgcagagttc ccggacagat tgaagtgcta agaggctttc tagaggatgt ggtgcctgat gccacctccg cgtaccccta cctcctcctg tatgagagcc gccagaggcg ctacctcggc tcttcgccgg agggcagtgg gttctgcagc aaggaccgat ttgtggctta cccctgtgct gtgggccaga cggccttctc ctctgggagg cactactggg aggtgggcat gaacatcacc ggggacgcgt tgtgggccct gggtgtgtgc agggacaacg tgagccggaa agacagggtc cccaagtgcc ccgaaaacgg cttctgggtg gtgcagctgt ccaaggggac caagtactta tccaccttct ctgccctaac cccggtcatg ctgatggagc ctcccagcca catgggcatc ttcctggact tcgaagccgg ggaagtgtcc ttctacagtg taagcgatgg gtcccacctg cacacctact cccaggccac cttcccaggc cccctgcagc ctttcttctg cctgggggct ccgaagtctg gtcagatggt catctccaca gtgaccatgt gggtgaaagg atag. It is sometimes possible for the material contained within the vial of "TRIM17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
