Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRADD cdna clone

TRADD cDNA Clone

Gene Names
TRADD; Hs.89862
Synonyms
TRADD; TRADD cDNA Clone; TRADD cdna clone
Ordering
For Research Use Only!
Sequence
atggcagctgggcaaaatgggcacgaagagtgggtgggcagcgcatacctgtttgtggagtcctcgctggacaaggtggtcctgtcggatgcctacgcgcacccccagcagaaggtggcagtgtacagggctctgcaggctgccttggcagagagcggcgggagcccggacgtgctgcagatgctgaagatccaccgcagcgacccgcagctgatcgtgcagctgcgattctgcgggcggcagccctgtggccgcttcctccgcgcctaccgcgagggggcgctgcgcgccgcgctgcagaggagcctggcggccgcgctcgcccagcactcggtgccgctgcaactggagctgcgcgccggcgccgagcggctggacgctttgctggcggacgaggagcgctgtttgagttgcatcctagcccagcagcccgaccggctccgggatgaagaactggctgagctggaggatgcgctgcgaaatctgaagtgcggctcgggggcccggggtggcgacggggaggtcgcttcggcccccttgcagcccccggtgccctctctgtcggaggtgaagccgccgccgccgccgccacctgcccagacttttctgttccagggtcagcctgtagtgaatcggccgctgagcctgaaggaccaacagacgttcgcgcgctctgtgggtctcaaatggcgcaaggtggggcgctcactgcagcgaggctgccgggcgctgcgggacccggcgctggactcgctggcctacgagtacgagcgcgagggactgtacgagcaggccttccagctgctgcggcgcttcgtgcaggccgagggccgccgcgccacgctgcagcgcctggtggaggcactcgaggagaacgagctcaccagcctggcagaggacttgctgggcctgaccgatcccaatggcggcctggcctag
Sequence Length
939
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,904 Da
NCBI Official Full Name
Homo sapiens TNFRSF1A-associated via death domain, mRNA
NCBI Official Synonym Full Names
TNFRSF1A associated via death domain
NCBI Official Symbol
TRADD
NCBI Official Synonym Symbols
Hs.89862
NCBI Protein Information
tumor necrosis factor receptor type 1-associated DEATH domain protein
UniProt Protein Name
Tumor necrosis factor receptor type 1-associated DEATH domain protein
UniProt Gene Name
TRADD
UniProt Synonym Gene Names
TNFR1-associated DEATH domain protein
UniProt Entry Name
TRADD_HUMAN

NCBI Description

The protein encoded by this gene is a death domain containing adaptor molecule that interacts with TNFRSF1A/TNFR1 and mediates programmed cell death signaling and NF-kappaB activation. This protein binds adaptor protein TRAF2, reduces the recruitment of inhibitor-of-apoptosis proteins (IAPs) by TRAF2, and thus suppresses TRAF2 mediated apoptosis. This protein can also interact with receptor TNFRSF6/FAS and adaptor protein FADD/MORT1, and is involved in the Fas-induced cell death pathway. [provided by RefSeq, Jul 2008]

Uniprot Description

TRADD: Adapter molecule for TNFRSF1A/TNFR1 that specifically associates with the cytoplasmic domain of activated TNFRSF1A/TNFR1 mediating its interaction with FADD. Overexpression of TRADD leads to two major TNF-induced responses, apoptosis and activation of NF-kappa-B. Heterodimer with TNFRSF1A/TNFR1. Interacts with DAB2IP, FADD, HIPK2, KRT14, KRT16, KRT17, KRT18, RIPK1, SQSTM1, TRAF1, TRAF2 and TRPC4AP. Found in all examined tissues.

Protein type: Apoptosis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 16q22

Cellular Component: cytoplasm; cytosol; plasma membrane; receptor complex

Molecular Function: identical protein binding; kinase binding; molecular adaptor activity; protein binding

Biological Process: activation of NF-kappaB transcription factor; apoptosis; caspase activation; I-kappaB kinase/NF-kappaB cascade; induction of apoptosis via death domain receptors; positive regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; signal transduction; tumor necrosis factor-mediated signaling pathway

Research Articles on TRADD

Similar Products

Product Notes

The TRADD tradd (Catalog #AAA1275802) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctg ggcaaaatgg gcacgaagag tgggtgggca gcgcatacct gtttgtggag tcctcgctgg acaaggtggt cctgtcggat gcctacgcgc acccccagca gaaggtggca gtgtacaggg ctctgcaggc tgccttggca gagagcggcg ggagcccgga cgtgctgcag atgctgaaga tccaccgcag cgacccgcag ctgatcgtgc agctgcgatt ctgcgggcgg cagccctgtg gccgcttcct ccgcgcctac cgcgaggggg cgctgcgcgc cgcgctgcag aggagcctgg cggccgcgct cgcccagcac tcggtgccgc tgcaactgga gctgcgcgcc ggcgccgagc ggctggacgc tttgctggcg gacgaggagc gctgtttgag ttgcatccta gcccagcagc ccgaccggct ccgggatgaa gaactggctg agctggagga tgcgctgcga aatctgaagt gcggctcggg ggcccggggt ggcgacgggg aggtcgcttc ggcccccttg cagcccccgg tgccctctct gtcggaggtg aagccgccgc cgccgccgcc acctgcccag acttttctgt tccagggtca gcctgtagtg aatcggccgc tgagcctgaa ggaccaacag acgttcgcgc gctctgtggg tctcaaatgg cgcaaggtgg ggcgctcact gcagcgaggc tgccgggcgc tgcgggaccc ggcgctggac tcgctggcct acgagtacga gcgcgaggga ctgtacgagc aggccttcca gctgctgcgg cgcttcgtgc aggccgaggg ccgccgcgcc acgctgcagc gcctggtgga ggcactcgag gagaacgagc tcaccagcct ggcagaggac ttgctgggcc tgaccgatcc caatggcggc ctggcctag. It is sometimes possible for the material contained within the vial of "TRADD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.