TPTE cdna clone
TPTE cDNA Clone
Gene Names
TPTE; CT44; PTEN2
Synonyms
TPTE; TPTE cDNA Clone; TPTE cdna clone
Sequence
atgaatgaaagtcctgatccgactgacctggcgggagtcatcattgagctcggccccaatgacagtccacagacaagtgaatttaaaggagcaaccgaggaggcacctgcgaaagaaagtgtgttagcacgactttccaagtttgaagttgaagatgctgaaaatgttgcttcatatgacagcaagattaagaaaattgtgcattcaattgtatcatcctttgcatttggactatttggagttttcctggtcttactggatgtcactctcatccttgccgacctaattttcactgacagcaaactttatattcctttggagtatcgttctatttctctagctattgccttattttttctcatggatgttcttcttcgagtatttgtagaaaggagacagcagtatttttctgacttatttaacattttagatactgccattattgtgattcttctgctggttgatgtcgtttacattttttttgacattaagttgcttaggaatattcccagatggacacatttacttcgacttctacgacttattattctgttaagaatttttcatctgtttcatcaaaaaagacaacttgaaaagctgataagaaggcgggtttcagaaaacaaaaggcgatacacaagggatggatttgacctagacctcacttacgttacagaacgtattattgctatgtcatttccatcttctggaaggcagtctttctatagaaatccaatcaaggaagttgtgcggtttctagataagaaacaccgaaaccactatcgagtctacaatctatgcagtgaaagagcttacgatcctaagcacttccataatagggtcgttagaatcatgattgatgatcataatgtccccactctacatcagatggtggttttcaccaaggaagtaaatgagtggatggctcaagatcttgaaaacatcgtagcgattcactgtaaaggaggcacagatagaacaggaactatggtttgtgccttccttattgcctctgaaatatgttcaactgcaaaggaaagcctgtattattttggagaaaggcgaacagataaaacccacagcgaaaaatttcagggagtagaaactccttctcagaagagatatgttgcatattttgcacaagtgaaacatctctacaactggaatctccctccaagacggatactctttataaaacacttcattatttattcgattcctcgttatgtacgtgatctaaaaatccaaatagaaatggagaaaaaggttgtcttttccactatttcattaggaaaatgttcggtacttgataacattacaacagacaaaatattaattgatgtattcgacggtccacctctgtatgatgatgtgaaagtgcagtttttctattcgaatcttcctacatactatgacaattgctcattttacttctggttgcacacatcttttattgaaaataacaggctttatctaccaaaaaatgaattggataatctacataaacaaaaagcacggagaatttatccatcagattttgccgtggagatactttttggcgagaaaatgacttccagtgatgttgtagctggatccgattaa
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,344 Da
NCBI Official Full Name
Homo sapiens transmembrane phosphatase with tensin homology, mRNA
NCBI Official Synonym Full Names
transmembrane phosphatase with tensin homology
NCBI Official Symbol
TPTE
NCBI Official Synonym Symbols
CT44; PTEN2
NCBI Protein Information
putative tyrosine-protein phosphatase TPTE
UniProt Protein Name
Putative tyrosine-protein phosphatase TPTE
Protein Family
UniProt Gene Name
TPTE
UniProt Synonym Gene Names
CT44
UniProt Entry Name
TPTE_HUMAN
NCBI Description
This gene encodes a PTEN-related tyrosine phosphatase which may play a role in the signal transduction pathways of the endocrine or spermatogenic function of the testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Uniprot Description
TPTE: Could be involved in signal transduction. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral; Cancer Testis Antigen (CTA); Motility/polarity/chemotaxis; EC 3.1.3.48; Receptor protein phosphatase, tyrosine
Chromosomal Location of Human Ortholog: 21p11
Biological Process: protein amino acid dephosphorylation; signal transduction
Research Articles on TPTE
Similar Products
Product Notes
The TPTE tpte (Catalog #AAA1265719) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaaa gtcctgatcc gactgacctg gcgggagtca tcattgagct cggccccaat gacagtccac agacaagtga atttaaagga gcaaccgagg aggcacctgc gaaagaaagt gtgttagcac gactttccaa gtttgaagtt gaagatgctg aaaatgttgc ttcatatgac agcaagatta agaaaattgt gcattcaatt gtatcatcct ttgcatttgg actatttgga gttttcctgg tcttactgga tgtcactctc atccttgccg acctaatttt cactgacagc aaactttata ttcctttgga gtatcgttct atttctctag ctattgcctt attttttctc atggatgttc ttcttcgagt atttgtagaa aggagacagc agtatttttc tgacttattt aacattttag atactgccat tattgtgatt cttctgctgg ttgatgtcgt ttacattttt tttgacatta agttgcttag gaatattccc agatggacac atttacttcg acttctacga cttattattc tgttaagaat ttttcatctg tttcatcaaa aaagacaact tgaaaagctg ataagaaggc gggtttcaga aaacaaaagg cgatacacaa gggatggatt tgacctagac ctcacttacg ttacagaacg tattattgct atgtcatttc catcttctgg aaggcagtct ttctatagaa atccaatcaa ggaagttgtg cggtttctag ataagaaaca ccgaaaccac tatcgagtct acaatctatg cagtgaaaga gcttacgatc ctaagcactt ccataatagg gtcgttagaa tcatgattga tgatcataat gtccccactc tacatcagat ggtggttttc accaaggaag taaatgagtg gatggctcaa gatcttgaaa acatcgtagc gattcactgt aaaggaggca cagatagaac aggaactatg gtttgtgcct tccttattgc ctctgaaata tgttcaactg caaaggaaag cctgtattat tttggagaaa ggcgaacaga taaaacccac agcgaaaaat ttcagggagt agaaactcct tctcagaaga gatatgttgc atattttgca caagtgaaac atctctacaa ctggaatctc cctccaagac ggatactctt tataaaacac ttcattattt attcgattcc tcgttatgta cgtgatctaa aaatccaaat agaaatggag aaaaaggttg tcttttccac tatttcatta ggaaaatgtt cggtacttga taacattaca acagacaaaa tattaattga tgtattcgac ggtccacctc tgtatgatga tgtgaaagtg cagtttttct attcgaatct tcctacatac tatgacaatt gctcatttta cttctggttg cacacatctt ttattgaaaa taacaggctt tatctaccaa aaaatgaatt ggataatcta cataaacaaa aagcacggag aatttatcca tcagattttg ccgtggagat actttttggc gagaaaatga cttccagtga tgttgtagct ggatccgatt aa. It is sometimes possible for the material contained within the vial of "TPTE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
