TP53I13 cdna clone
TP53I13 cDNA Clone
Gene Names
TP53I13; DSCP1
Synonyms
TP53I13; TP53I13 cDNA Clone; TP53I13 cdna clone
Sequence
atggctggaccggcggaggaggcgggagcccattgtcccgagagcctgtggcctctgcctccgcaggtgtcaccaagagtgacctacacacgagtgagcccagggcaggctgaggatgtcaccttcctctaccacccctgtgcccatccctggctgaagctccagcttgccctcctggcctatgcttgtatggctaacccttccctcacccctgacttcagcctcacgcaggatcggcccctggtgctgactgcatgggggctggcgctggagatggcctgggtagagccagcctgggctgcccactggctgatgaggaggcggaggaggaagcagaggaagaagaaggcatggatctactgtgaaagcctttcagggcctgctccctccgagccaactcccggtagagggaggctgtgccgaagagggtgtgtgcaggccctggctctggcctttgctctgcggagctggcggccccctggcacagaggtgacatctcaagggcccaggcagccctcttctagtggtgccaagaggcggaggctgcgggctgcccttggtccccagcccactcgctcagccctgaggtttccctctgcttccccagggagcttgaaggccaagcagtccatggcgggaatccctggtagggagagtaatgccccatctgtgcccactgtctccctgctgccgggggcgcctggaggcaatgccagctccaggacagaggctcaggtgcccaacgggcaaggcagcccagggggctgtgtctgttcaagtcaggcttccccggcccctcgcgcagcagcgcctccacgggcagcccggggccccaccccacgcactgaagaggccgcctgggctgccatggccctgaccttcctgctggtgctgctcaccctggccacgctctgcacacggctgcacagaaacttccgacgcggggagagcatctactgggggcccacagcggacagccaggacacagtggctgctgtgctgaagcggaggctgctgcagccctcgcgccgggtcaagcgctcgcgccggagacccctcctcccgcccacgccggacagcggcccggaaggcgagagctcggagtga
Sequence Length
1107
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,238 Da
NCBI Official Full Name
Homo sapiens tumor protein p53 inducible protein 13, mRNA
NCBI Official Synonym Full Names
tumor protein p53 inducible protein 13
NCBI Official Symbol
TP53I13
NCBI Official Synonym Symbols
DSCP1
NCBI Protein Information
tumor protein p53-inducible protein 13
UniProt Protein Name
Tumor protein p53-inducible protein 13
Protein Family
UniProt Gene Name
TP53I13
UniProt Synonym Gene Names
DSCP1
UniProt Entry Name
P5I13_HUMAN
Uniprot Description
TP53I13: May act as a tumor suppressor. Inhibits tumor cell growth, when overexpressed.
Protein type: Membrane protein, integral; Cell surface
Chromosomal Location of Human Ortholog: 17q11.2
Similar Products
Product Notes
The TP53I13 tp53i13 (Catalog #AAA1271173) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggac cggcggagga ggcgggagcc cattgtcccg agagcctgtg gcctctgcct ccgcaggtgt caccaagagt gacctacaca cgagtgagcc cagggcaggc tgaggatgtc accttcctct accacccctg tgcccatccc tggctgaagc tccagcttgc cctcctggcc tatgcttgta tggctaaccc ttccctcacc cctgacttca gcctcacgca ggatcggccc ctggtgctga ctgcatgggg gctggcgctg gagatggcct gggtagagcc agcctgggct gcccactggc tgatgaggag gcggaggagg aagcagagga agaagaaggc atggatctac tgtgaaagcc tttcagggcc tgctccctcc gagccaactc ccggtagagg gaggctgtgc cgaagagggt gtgtgcaggc cctggctctg gcctttgctc tgcggagctg gcggccccct ggcacagagg tgacatctca agggcccagg cagccctctt ctagtggtgc caagaggcgg aggctgcggg ctgcccttgg tccccagccc actcgctcag ccctgaggtt tccctctgct tccccaggga gcttgaaggc caagcagtcc atggcgggaa tccctggtag ggagagtaat gccccatctg tgcccactgt ctccctgctg ccgggggcgc ctggaggcaa tgccagctcc aggacagagg ctcaggtgcc caacgggcaa ggcagcccag ggggctgtgt ctgttcaagt caggcttccc cggcccctcg cgcagcagcg cctccacggg cagcccgggg ccccacccca cgcactgaag aggccgcctg ggctgccatg gccctgacct tcctgctggt gctgctcacc ctggccacgc tctgcacacg gctgcacaga aacttccgac gcggggagag catctactgg gggcccacag cggacagcca ggacacagtg gctgctgtgc tgaagcggag gctgctgcag ccctcgcgcc gggtcaagcg ctcgcgccgg agacccctcc tcccgcccac gccggacagc ggcccggaag gcgagagctc ggagtga. It is sometimes possible for the material contained within the vial of "TP53I13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
