Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMPRSS6 cdna clone

TMPRSS6 cDNA Clone

Gene Names
TMPRSS6; IRIDA
Synonyms
TMPRSS6; TMPRSS6 cDNA Clone; TMPRSS6 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgttactcttccactccaaaaggatgcccgtggccgaggccccccaggtggctggcgggcagggggacggaggtgatggcgaggaagcggagccagaggggatgttcaaggcctgtgaggactccaagagaaaagcccggggctacctccgcctggtgcccctgtttgtgctgctggccctgctcgtgctggcttcggcgggggtgctactctggtatttcctagggtacaaggcggaggtgatggtcagccaggtgtactcaggcagtctgcgtgtactcaatcgccacttctcccaggatcttacccgccgggaatctagtgccttccgcagtgaaaccgccaaagcccagaagatgctcaaggagctcatcaccagcacccgcctgggaacttactacaactccagctccgtctattcctttggggagggacccctcacctgcttcttctggttcattctccaaatccccgagcaccgccggctgatgctgagccccgaggtggtgcaggcactgctggtggaggagctgctgtccacagtcaacagctcggctgccgtcccctacagggccgagtacgaagtggaccccgagggcctagtgatcctggaagccagtgtgaaagacatagctgcattgaattccacgctgggttgttaccgctacagctacgtgggccagggccaggtcctccggctgaaggggcctgaccacctggcctccagctgcctgtggcacctgcagggccccaaggacctcatgctcaaactccggctggagtggacgctggcagagtgccgggaccgactggccatgtatgacgtggccgggcccctggagaagaggctcatcacctcggtgtacggctgcagccgccaggagcccgtggtggaggttctggcgtcgggggccatcatggcggtcgtctggaagaagggcctgcacagctactacgaccccttcgtgctctccgtgcagccggtggtcttccaggcctgtgaagtgaacctgacgctggacaacaggctcgactcccagggcgtcctcagcaccccgtacttccccagctactactcgccccaaacccactgctcctggcacctcacggtgccctctctggactacggcttggccctctggtttgatgcctatgcactgaggaggcagaagtatgatttgccgtgcacccagggccagtggacgatccagaacaggaggtaccacttcctctcctccctctggcttcctttcctccctccccctccctctcttccctcctcaacagtgaccccctcattggaagcccaagtccccaatctcagaggggcagcaaggggagcgagcagaggctggggctggtgtcaggcctgctgcccttga
Sequence Length
1386
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,333 Da
NCBI Official Full Name
Homo sapiens transmembrane protease, serine 6, mRNA
NCBI Official Synonym Full Names
transmembrane protease, serine 6
NCBI Official Symbol
TMPRSS6
NCBI Official Synonym Symbols
IRIDA
NCBI Protein Information
transmembrane protease serine 6
UniProt Protein Name
Transmembrane protease serine 6
UniProt Gene Name
TMPRSS6
UniProt Entry Name
TMPS6_HUMAN

NCBI Description

The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

TMPRSS6: Serine protease which hydrolyzes a range of proteins including type I collagen, fibronectin and fibrinogen. Can also activate urokinase-type plasminogen activator with low efficiency. May play a specialized role in matrix remodeling processes in liver. Plays a role in the regulation of iron homeostasis, a process involving HAMP. Required to sense iron deficiency and suppress activation of the HAMP promoter. Defects in TMPRSS6 are the cause of iron-refractory iron deficiency anemia (IRIDA); also known as hypochromic microcytic anemia with defect in iron metabolism or hereditary iron-handling disorder or pseudo-iron-deficiency anemia. Key features include congenital hypochromic microcytic anemia, very low mean corpuscular erythrocyte volume, low transferrin saturation, abnormal iron absorption characterized by no hematologic improvement following treatment with oral iron, and abnormal iron utilization characterized by a sluggish, incomplete response to parenteral iron. Mutations leading to abrogation of TMPRSS6 activity are associated with IRIDA due to elevated levels of hepcidin, a negative regulator of plasma iron pool (PubMed:20232450). Belongs to the peptidase S1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Membrane protein, integral; EC 3.4.21.-

Chromosomal Location of Human Ortholog: 22q12.3

Cellular Component: extracellular space; integral to membrane; plasma membrane

Molecular Function: protein binding; serine-type endopeptidase activity

Biological Process: cellular iron ion homeostasis; fibrinolysis; iron ion homeostasis; membrane protein proteolysis; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; proteolysis

Disease: Iron-refractory Iron Deficiency Anemia

Research Articles on TMPRSS6

Similar Products

Product Notes

The TMPRSS6 tmprss6 (Catalog #AAA1278190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgttac tcttccactc caaaaggatg cccgtggccg aggcccccca ggtggctggc gggcaggggg acggaggtga tggcgaggaa gcggagccag aggggatgtt caaggcctgt gaggactcca agagaaaagc ccggggctac ctccgcctgg tgcccctgtt tgtgctgctg gccctgctcg tgctggcttc ggcgggggtg ctactctggt atttcctagg gtacaaggcg gaggtgatgg tcagccaggt gtactcaggc agtctgcgtg tactcaatcg ccacttctcc caggatctta cccgccggga atctagtgcc ttccgcagtg aaaccgccaa agcccagaag atgctcaagg agctcatcac cagcacccgc ctgggaactt actacaactc cagctccgtc tattcctttg gggagggacc cctcacctgc ttcttctggt tcattctcca aatccccgag caccgccggc tgatgctgag ccccgaggtg gtgcaggcac tgctggtgga ggagctgctg tccacagtca acagctcggc tgccgtcccc tacagggccg agtacgaagt ggaccccgag ggcctagtga tcctggaagc cagtgtgaaa gacatagctg cattgaattc cacgctgggt tgttaccgct acagctacgt gggccagggc caggtcctcc ggctgaaggg gcctgaccac ctggcctcca gctgcctgtg gcacctgcag ggccccaagg acctcatgct caaactccgg ctggagtgga cgctggcaga gtgccgggac cgactggcca tgtatgacgt ggccgggccc ctggagaaga ggctcatcac ctcggtgtac ggctgcagcc gccaggagcc cgtggtggag gttctggcgt cgggggccat catggcggtc gtctggaaga agggcctgca cagctactac gaccccttcg tgctctccgt gcagccggtg gtcttccagg cctgtgaagt gaacctgacg ctggacaaca ggctcgactc ccagggcgtc ctcagcaccc cgtacttccc cagctactac tcgccccaaa cccactgctc ctggcacctc acggtgccct ctctggacta cggcttggcc ctctggtttg atgcctatgc actgaggagg cagaagtatg atttgccgtg cacccagggc cagtggacga tccagaacag gaggtaccac ttcctctcct ccctctggct tcctttcctc cctccccctc cctctcttcc ctcctcaaca gtgaccccct cattggaagc ccaagtcccc aatctcagag gggcagcaag gggagcgagc agaggctggg gctggtgtca ggcctgctgc ccttga. It is sometimes possible for the material contained within the vial of "TMPRSS6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.