Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMED3 cdna clone

TMED3 cDNA Clone

Gene Names
TMED3; p26; P24B; p24g4; C15orf22
Synonyms
TMED3; TMED3 cDNA Clone; TMED3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcagcactgtcccgcgctccgcctccgtgctgcttctgctgctgctcctgcgccgggccgagcagccctgcggggccgagctcaccttcgagctgccggacaacgccaagcagtgcttccacgaggaggtggagcagggcgtgaagttctccctggattaccaggtcatcactggaggccactacgatgttgactgctatgtagaggacccccaggggaacaccatctacagagaaacgaagaagcagtacgacagcttcacgtaccgggctgaagtcaagggcgtttatcagttttgcttcagtaatgagttttccaccttctctcacaagaccgtctactttgactttcaagtgggcgatgagcctcccattctcccagacatggggaacagggtcacagctctcacccagatggagtccgcctgcgtgaccatccatgaggctctgaaaacggtgattgactcccagacgcattaccggctgcgggaggcccaggaccgggcccgagcggaagaccttaatagccgagtctcttactggtctgttggcgagacgattgccctgttcgtggtcagcttcagtcaggtgctactgttgaaaagcttcttcacagaaaaacgacccatcagcagggcagtccactcctag
Sequence Length
654
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,635 Da
NCBI Official Full Name
Homo sapiens transmembrane emp24 protein transport domain containing 3, mRNA
NCBI Official Synonym Full Names
transmembrane p24 trafficking protein 3
NCBI Official Symbol
TMED3
NCBI Official Synonym Symbols
p26; P24B; p24g4; C15orf22
NCBI Protein Information
transmembrane emp24 domain-containing protein 3
UniProt Protein Name
Transmembrane emp24 domain-containing protein 3
UniProt Gene Name
TMED3
UniProt Synonym Gene Names
C15orf22; p24gamma4
UniProt Entry Name
TMED3_HUMAN

Uniprot Description

TMED3: Potential role in vesicular protein trafficking, mainly in the early secretory pathway. Contributes to the coupled localization of TMED2 and TMED10 in the cis-Golgi network. Belongs to the EMP24/GP25L family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 15q24-q25

Cellular Component: COPI vesicle coat; endoplasmic reticulum; endoplasmic reticulum membrane; ER-Golgi intermediate compartment; ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi membrane; transport vesicle

Biological Process: ER to Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on TMED3

Similar Products

Product Notes

The TMED3 tmed3 (Catalog #AAA1274128) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcagca ctgtcccgcg ctccgcctcc gtgctgcttc tgctgctgct cctgcgccgg gccgagcagc cctgcggggc cgagctcacc ttcgagctgc cggacaacgc caagcagtgc ttccacgagg aggtggagca gggcgtgaag ttctccctgg attaccaggt catcactgga ggccactacg atgttgactg ctatgtagag gacccccagg ggaacaccat ctacagagaa acgaagaagc agtacgacag cttcacgtac cgggctgaag tcaagggcgt ttatcagttt tgcttcagta atgagttttc caccttctct cacaagaccg tctactttga ctttcaagtg ggcgatgagc ctcccattct cccagacatg gggaacaggg tcacagctct cacccagatg gagtccgcct gcgtgaccat ccatgaggct ctgaaaacgg tgattgactc ccagacgcat taccggctgc gggaggccca ggaccgggcc cgagcggaag accttaatag ccgagtctct tactggtctg ttggcgagac gattgccctg ttcgtggtca gcttcagtca ggtgctactg ttgaaaagct tcttcacaga aaaacgaccc atcagcaggg cagtccactc ctag. It is sometimes possible for the material contained within the vial of "TMED3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.