Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TLR4 cdna clone

TLR4 cDNA Clone

Gene Names
TLR4; TOLL; CD284; TLR-4; ARMD10
Synonyms
TLR4; TLR4 cDNA Clone; TLR4 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgtctgcctcgcgcctggctgggactctgatcccagccatggccttcctctcctgcgtgagaccagaaagctgggagccctgcgtggaggtggttcctaatattacttatcaatgcatggagctgaatttctacaaaatccccgacaacctccccttctcaaccaagaacctggacctgagctttaatcccctgaggcatttaggcagctatagcttcttcagtttcccagaactgcaggtgctggatttatccaggtgtgaaatccagacaattgaagatggggcatatcagagcctaagccacctctctaccttaatattgacaggaaaccccatccagagtttagccctgggagccttttctggactatcaagtttacagaagctggtggctgtggagacaaatctagcatctctagagaacttccccattggacatctcaaaactttgaaagaacttaatgtggctcacaatcttatccaatctttcaaattacctgagtatttttctaatctgaccaatctagagcacttggacctttccagcaacaagattcaaagtatttattgcacagacttgcgggttctacatcaaatgcccctactcaatctctctttagacctgtccctgaaccctatgaactttatccaaccaggtgcatttaaagaaattaggcttcataagctgactttaagaaataattttgatagtttaaatgtaatgaaaacttgtattcaaggtctggctggtttagaagtccatcgtttggttctgggagaatttagaaatgaaggaaacttggaaaagtttgacaaatctgctctagagggcctgtgcaatttgaccattgaagaattccgattagcatacttagactactacctcgatgatattattgacttatttaattgtttgacaaatgtttcttcattttccctggtgagtgtgactattgaaagggtaaaagacttttcttataatttcggatggcaacatttagaattagttaactgtaaatttggacagtttcccacattgaaactcaaatctctcaaaaggcttactttcacttccaacaaaggtgggaatgctttttcagaagttgatctaccaagccttgagtttctagatctcagtagaaatggcttgagtttcaaaggttgctgttctcaaagtgattttgggacaaccagcctaaagtatttagatctgagcttcaatggtgttattaccatgagttcaaacttcttgggcttagaacaactagaacatctggatttccagcattccaatttgaaacaaatgagtgagttttcagtattcctatcactcagaaacctcatttaccttgacatttctcatactcacaccagagttgctttcaatggcatcttcaatggcttgtccagtctcgaagtcttgaaaatggctggcaattctttccaggaaaacttccttccagatatcttcacagagctgagaaacttgaccttcctggacctctctcagtgtcaactggagcagttgtctccaacagcatttaactcactctccagtcttcaggtactaaatatgagccacaacaacttcttttcattggatacgtttccttataagtgtctgaactccctccaggttcttgattacagtctcaatcacataatgacttccaaaaaacaggaactacagcattttccaagtagtctagctttcttaaatcttactcagaatgactttgcttgtacttgtgaacaccagagtttcctgcaatggatcaaggaccagaggcagctcttggtggaagttgaacgaatggaatgtgcaacaccttcagataagcagggcatgcctgtgctgagtttgaatatcacctgtcagatgaataagaccatcattggtgtgtcggtcctcagtgtgcttgtagtatctgttgtagcagttctggtctataagttctattttcacctgatgcttcttgctggctgcataaagtatggtagaggtgaaaacatctatgatgcctttgttatctactcaagccaggatgaggactgggtaaggaatgagctagtaaagaatttagaagaaggggtgcctccatttcagctctgccttcactacagagactttattcccggtgtggccattgctgccaacatcatccatgaaggtttccataaaagccgaaaggtgattgttgtggtgtcccagcacttcatccagagccgctggtgtatctttgaatatgagattgctcagacctggcagtttctgagcagtcgtgctggtatcatcttcattgtcctgcagaaggtggagaagaccctgctcaggcagcaggtggagctgtaccgccttctcagcaggaacacttacctggagtgggaggacagtgtcctggggcggcacatcttctggagacgactcagaaaagccctgctggatggtaaatcatggaatccagaaggaacagtgggtacaggatgcaattggcaggaagcaacatctatctga
Sequence Length
2520
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,301 Da
NCBI Official Full Name
Homo sapiens toll-like receptor 4, mRNA
NCBI Official Synonym Full Names
toll like receptor 4
NCBI Official Symbol
TLR4
NCBI Official Synonym Symbols
TOLL; CD284; TLR-4; ARMD10
NCBI Protein Information
toll-like receptor 4
UniProt Protein Name
Toll-like receptor 4
Protein Family
UniProt Gene Name
TLR4
UniProt Entry Name
TLR4_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

TLR4: Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). Acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Also involved in LPS- independent inflammatory responses triggered by Ni(2+). These responses require non-conserved histidines and are, therefore, species-specific. Belongs to the lipopolysaccharide (LPS) receptor, a multi-protein complex containing at least CD14, LY96 and TLR4. Binding to bacterial LPS leads to homodimerization. Interacts with LY96 via the extracellular domain. Interacts with MYD88 and TIRAP via their respective TIR domains. Interacts with NOX4. Interacts with CNPY3. Interacts with HSP90B1. The interaction with both CNPY3 and HSP90B1 is required for proper folding in the endoplasmic reticulum. Highly expressed in placenta, spleen and peripheral blood leukocytes. Detected in monocytes, macrophages, dendritic cells and several types of T-cells. Belongs to the Toll-like receptor family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 9q33.1

Cellular Component: cell surface; cytoplasm; endosome membrane; external side of plasma membrane; integral to plasma membrane; intrinsic to plasma membrane; lipopolysaccharide receptor complex; perinuclear region of cytoplasm; plasma membrane

Molecular Function: lipopolysaccharide binding; lipopolysaccharide receptor activity; protein binding; receptor activity

Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; defense response to bacterium; defense response to Gram-negative bacterium; detection of lipopolysaccharide; I-kappaB kinase/NF-kappaB cascade; I-kappaB phosphorylation; immune response; inflammatory response; innate immune response; interleukin-1 beta secretion; lipopolysaccharide-mediated signaling pathway; macrophage activation; MyD88-dependent toll-like receptor signaling pathway; MyD88-independent toll-like receptor signaling pathway; negative regulation of interferon-gamma production; negative regulation of interleukin-17 production; negative regulation of interleukin-23 production; negative regulation of interleukin-6 production; negative regulation of MyD88-independent toll-like receptor signaling pathway; negative regulation of tumor necrosis factor production; positive regulation of chemokine production; positive regulation of inflammatory response; positive regulation of interferon-alpha production; positive regulation of interferon-beta production; positive regulation of interferon-gamma production; positive regulation of interleukin-1 production; positive regulation of interleukin-10 production; positive regulation of interleukin-12 biosynthetic process; positive regulation of interleukin-12 production; positive regulation of interleukin-6 production; positive regulation of interleukin-8 biosynthetic process; positive regulation of interleukin-8 production; positive regulation of NF-kappaB import into nucleus; positive regulation of nitric-oxide synthase biosynthetic process; positive regulation of transcription from RNA polymerase II promoter; positive regulation of tumor necrosis factor biosynthetic process; positive regulation of tumor necrosis factor production; response to lipopolysaccharide; toll-like receptor 4 signaling pathway; toll-like receptor signaling pathway

Disease: Macular Degeneration, Age-related, 10

Research Articles on TLR4

Similar Products

Product Notes

The TLR4 tlr4 (Catalog #AAA1274976) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtctg cctcgcgcct ggctgggact ctgatcccag ccatggcctt cctctcctgc gtgagaccag aaagctggga gccctgcgtg gaggtggttc ctaatattac ttatcaatgc atggagctga atttctacaa aatccccgac aacctcccct tctcaaccaa gaacctggac ctgagcttta atcccctgag gcatttaggc agctatagct tcttcagttt cccagaactg caggtgctgg atttatccag gtgtgaaatc cagacaattg aagatggggc atatcagagc ctaagccacc tctctacctt aatattgaca ggaaacccca tccagagttt agccctggga gccttttctg gactatcaag tttacagaag ctggtggctg tggagacaaa tctagcatct ctagagaact tccccattgg acatctcaaa actttgaaag aacttaatgt ggctcacaat cttatccaat ctttcaaatt acctgagtat ttttctaatc tgaccaatct agagcacttg gacctttcca gcaacaagat tcaaagtatt tattgcacag acttgcgggt tctacatcaa atgcccctac tcaatctctc tttagacctg tccctgaacc ctatgaactt tatccaacca ggtgcattta aagaaattag gcttcataag ctgactttaa gaaataattt tgatagttta aatgtaatga aaacttgtat tcaaggtctg gctggtttag aagtccatcg tttggttctg ggagaattta gaaatgaagg aaacttggaa aagtttgaca aatctgctct agagggcctg tgcaatttga ccattgaaga attccgatta gcatacttag actactacct cgatgatatt attgacttat ttaattgttt gacaaatgtt tcttcatttt ccctggtgag tgtgactatt gaaagggtaa aagacttttc ttataatttc ggatggcaac atttagaatt agttaactgt aaatttggac agtttcccac attgaaactc aaatctctca aaaggcttac tttcacttcc aacaaaggtg ggaatgcttt ttcagaagtt gatctaccaa gccttgagtt tctagatctc agtagaaatg gcttgagttt caaaggttgc tgttctcaaa gtgattttgg gacaaccagc ctaaagtatt tagatctgag cttcaatggt gttattacca tgagttcaaa cttcttgggc ttagaacaac tagaacatct ggatttccag cattccaatt tgaaacaaat gagtgagttt tcagtattcc tatcactcag aaacctcatt taccttgaca tttctcatac tcacaccaga gttgctttca atggcatctt caatggcttg tccagtctcg aagtcttgaa aatggctggc aattctttcc aggaaaactt ccttccagat atcttcacag agctgagaaa cttgaccttc ctggacctct ctcagtgtca actggagcag ttgtctccaa cagcatttaa ctcactctcc agtcttcagg tactaaatat gagccacaac aacttctttt cattggatac gtttccttat aagtgtctga actccctcca ggttcttgat tacagtctca atcacataat gacttccaaa aaacaggaac tacagcattt tccaagtagt ctagctttct taaatcttac tcagaatgac tttgcttgta cttgtgaaca ccagagtttc ctgcaatgga tcaaggacca gaggcagctc ttggtggaag ttgaacgaat ggaatgtgca acaccttcag ataagcaggg catgcctgtg ctgagtttga atatcacctg tcagatgaat aagaccatca ttggtgtgtc ggtcctcagt gtgcttgtag tatctgttgt agcagttctg gtctataagt tctattttca cctgatgctt cttgctggct gcataaagta tggtagaggt gaaaacatct atgatgcctt tgttatctac tcaagccagg atgaggactg ggtaaggaat gagctagtaa agaatttaga agaaggggtg cctccatttc agctctgcct tcactacaga gactttattc ccggtgtggc cattgctgcc aacatcatcc atgaaggttt ccataaaagc cgaaaggtga ttgttgtggt gtcccagcac ttcatccaga gccgctggtg tatctttgaa tatgagattg ctcagacctg gcagtttctg agcagtcgtg ctggtatcat cttcattgtc ctgcagaagg tggagaagac cctgctcagg cagcaggtgg agctgtaccg ccttctcagc aggaacactt acctggagtg ggaggacagt gtcctggggc ggcacatctt ctggagacga ctcagaaaag ccctgctgga tggtaaatca tggaatccag aaggaacagt gggtacagga tgcaattggc aggaagcaac atctatctga. It is sometimes possible for the material contained within the vial of "TLR4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.