TIMM17A cdna clone
TIMM17A cDNA Clone
Gene Names
TIMM17A; TIM17; TIM17A
Synonyms
TIMM17A; TIMM17A cDNA Clone; TIMM17A cdna clone
Sequence
atggaggagtacgcgcgagagccttgcccatggcgaattgtggatgactgtggtggggcctttacgatgggtaccattggtggtggtatctttcaagcaatcaaaggttttcgcaattctccagtgggagtaaaccacagactacgagggagtttgacagctattaaaaccagggctccacagttaggaggtagctttgcagtttggggagggctgttttccatgattgactgtagtatggttcaagtcagaggaaaggaagatccctggaactccatcacaagtggtgccttaacgggagccatactggcagcaagaaatggaccagtggccatggttgggtcagccgcaatgggtggcattctcctagctttaattgaaggagctggtatcttgttgacaagatttgcctctgcacagtttcccaatggtcctcagtttgcagaagacccctcccagttgccttcaactcagttaccttcctcaccttttggagactatcgacaatatcagtag
Sequence Length
516
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,024 Da
NCBI Official Full Name
Homo sapiens translocase of inner mitochondrial membrane 17 homolog A (yeast), mRNA
NCBI Official Synonym Full Names
translocase of inner mitochondrial membrane 17 homolog A (yeast)
NCBI Official Symbol
TIMM17A
NCBI Official Synonym Symbols
TIM17; TIM17A
NCBI Protein Information
mitochondrial import inner membrane translocase subunit Tim17-A
UniProt Protein Name
Mitochondrial import inner membrane translocase subunit Tim17-A
Protein Family
UniProt Gene Name
TIMM17A
UniProt Synonym Gene Names
MIMT17; TIM17; TIM17A; TIMM17
UniProt Entry Name
TI17A_HUMAN
Uniprot Description
TIMM17A: Essential component of the TIM23 complex, a complex that mediates the translocation of transit peptide-containing proteins across the mitochondrial inner membrane. Belongs to the Tim17/Tim22/Tim23 family.
Protein type: Transporter; Membrane protein, multi-pass; Mitochondrial; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1q32.1
Cellular Component: integral to mitochondrial inner membrane; mitochondrial inner membrane; mitochondrial inner membrane presequence translocase complex; mitochondrion; nucleoplasm
Molecular Function: protein channel activity
Biological Process: protein import into mitochondrial matrix; protein targeting to mitochondrion
Research Articles on TIMM17A
Similar Products
Product Notes
The TIMM17A timm17a (Catalog #AAA1271630) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagt acgcgcgaga gccttgccca tggcgaattg tggatgactg tggtggggcc tttacgatgg gtaccattgg tggtggtatc tttcaagcaa tcaaaggttt tcgcaattct ccagtgggag taaaccacag actacgaggg agtttgacag ctattaaaac cagggctcca cagttaggag gtagctttgc agtttgggga gggctgtttt ccatgattga ctgtagtatg gttcaagtca gaggaaagga agatccctgg aactccatca caagtggtgc cttaacggga gccatactgg cagcaagaaa tggaccagtg gccatggttg ggtcagccgc aatgggtggc attctcctag ctttaattga aggagctggt atcttgttga caagatttgc ctctgcacag tttcccaatg gtcctcagtt tgcagaagac ccctcccagt tgccttcaac tcagttacct tcctcacctt ttggagacta tcgacaatat cagtag. It is sometimes possible for the material contained within the vial of "TIMM17A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
