Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCTE3 cdna clone

TCTE3 cDNA Clone

Gene Names
TCTE3; TCTEX1D3
Synonyms
TCTE3; TCTE3 cDNA Clone; TCTE3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagcgaggccgaggcgtgaagtcgagccccatccagaccccgaaccagacccctcagcaggctccggtgacgcctaggaaagaaaggaggcctagcatgttcgagaaggaggcatatacacagattttaagagaaagactgagagagtcaattcacaatgttcagtatgtggagcctccttttgatgactcaattgctgatataggtaaagaatggaagagtgccctggcaaaattaaagtttgctaattcatatagaatggagccattgaagaaattccaagctcattcagtagaaactaaagtccagcagatactaacagaaagtcttaaagatgtcaaatatgatgataaagtattctctcacttgtcacttgaattggcagaccgcatactgttagcagtcaaagaatttgggtaccaccgttataagttcattataaaagtattatttattcaaaagactggccaagcaataaatattgccagcagatggatctgggacattgcatgggacagctgggtcgcagctaaacacgaagcagaatcctacgtggcactggtcttggtgtttgccctttattatgaatag
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,176 Da
NCBI Official Full Name
Homo sapiens t-complex-associated-testis-expressed 3, mRNA
NCBI Official Synonym Full Names
t-complex-associated-testis-expressed 3
NCBI Official Symbol
TCTE3
NCBI Official Synonym Symbols
TCTEX1D3
NCBI Protein Information
tctex1 domain-containing protein 3
UniProt Protein Name
Tctex1 domain-containing protein 3
UniProt Gene Name
TCTE3
UniProt Synonym Gene Names
TCTEX1D3; Tcte-3
UniProt Entry Name
TC1D3_HUMAN

Uniprot Description

TCTE3: May be an accessory component of axonemal dynein and cytoplasmic dynein 1. Candidate for involvement in male sterility. Belongs to the dynein light chain Tctex-type family.

Protein type: Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 6q27

Research Articles on TCTE3

Similar Products

Product Notes

The TCTE3 tcte3 (Catalog #AAA1273843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagc gaggccgagg cgtgaagtcg agccccatcc agaccccgaa ccagacccct cagcaggctc cggtgacgcc taggaaagaa aggaggccta gcatgttcga gaaggaggca tatacacaga ttttaagaga aagactgaga gagtcaattc acaatgttca gtatgtggag cctccttttg atgactcaat tgctgatata ggtaaagaat ggaagagtgc cctggcaaaa ttaaagtttg ctaattcata tagaatggag ccattgaaga aattccaagc tcattcagta gaaactaaag tccagcagat actaacagaa agtcttaaag atgtcaaata tgatgataaa gtattctctc acttgtcact tgaattggca gaccgcatac tgttagcagt caaagaattt gggtaccacc gttataagtt cattataaaa gtattattta ttcaaaagac tggccaagca ataaatattg ccagcagatg gatctgggac attgcatggg acagctgggt cgcagctaaa cacgaagcag aatcctacgt ggcactggtc ttggtgtttg ccctttatta tgaatag. It is sometimes possible for the material contained within the vial of "TCTE3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.