Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCEA2 cdna clone

TCEA2 cDNA Clone

Gene Names
TCEA2; TFIIS
Synonyms
TCEA2; TCEA2 cDNA Clone; TCEA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgggcaaggaagaggagattgcgcggatcgcccggaggctggacaagatggtgaccaagaagagcgcggagggagccatggatttgctgcgggagctgaaggccatgcctatcacgctgcacctgctccagtccacccgagtcgggatgtctgtcaacgcccttcggaagcagagctcggatgaggaggtcattgcactggccaagtctctcatcaagtcctggaagaagctcctggatgcttccgatgccaaagccagggagcgggggaggggcatgcctctgcccacgtcctcgagggatgcctcagaggccccggatcccagccgcaagaggccggagctgcccagggcaccgtcgactccgaggatcaccacatttcctccggtgcctgtcacctgtgatgccgtgcgcaacaagtgccgcgagatgctgaccgctgccctgcagacggaccatgaccacgtggccatcggtgcggactgcgagcgcctgtcggctcagatcgaggaatgcatcttccgggacgttggaaacacagacatgaagtataagaaccgtgtacggagtcgtatctccaacctgaaggatgccaagaaccctgacctgcggcggaatgtgctgtgtggggccataacaccccagcagatcgctgtgatgacctcagaggagatggccagtgatgagctgaaggagatccgtaaggccatgaccaaggaggccatccgagagcaccagatggcccgcactggcggcacgcagacagacctgttcacctgcggcaagtgcaggaaaaagaactgcacctacacacaggtgcagacccgcagctctgatgagcccatgaccacctttgttgtctgcaacgagtgtggaaaccgctggaagttctgctga
Sequence Length
900
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,569 Da
NCBI Official Full Name
Homo sapiens transcription elongation factor A (SII), 2, mRNA
NCBI Official Synonym Full Names
transcription elongation factor A2
NCBI Official Symbol
TCEA2
NCBI Official Synonym Symbols
TFIIS
NCBI Protein Information
transcription elongation factor A protein 2
UniProt Protein Name
Transcription elongation factor A protein 2
UniProt Gene Name
TCEA2
UniProt Entry Name
TCEA2_HUMAN

NCBI Description

The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

TCEA2: Necessary for efficient RNA polymerase II transcription elongation past template-encoded arresting sites. The arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by S-II allows the resumption of elongation from the new 3'-terminus. Belongs to the TFS-II family.

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: centrosome; nucleoplasm

Molecular Function: protein binding

Research Articles on TCEA2

Similar Products

Product Notes

The TCEA2 tcea2 (Catalog #AAA1266222) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgggca aggaagagga gattgcgcgg atcgcccgga ggctggacaa gatggtgacc aagaagagcg cggagggagc catggatttg ctgcgggagc tgaaggccat gcctatcacg ctgcacctgc tccagtccac ccgagtcggg atgtctgtca acgcccttcg gaagcagagc tcggatgagg aggtcattgc actggccaag tctctcatca agtcctggaa gaagctcctg gatgcttccg atgccaaagc cagggagcgg gggaggggca tgcctctgcc cacgtcctcg agggatgcct cagaggcccc ggatcccagc cgcaagaggc cggagctgcc cagggcaccg tcgactccga ggatcaccac atttcctccg gtgcctgtca cctgtgatgc cgtgcgcaac aagtgccgcg agatgctgac cgctgccctg cagacggacc atgaccacgt ggccatcggt gcggactgcg agcgcctgtc ggctcagatc gaggaatgca tcttccggga cgttggaaac acagacatga agtataagaa ccgtgtacgg agtcgtatct ccaacctgaa ggatgccaag aaccctgacc tgcggcggaa tgtgctgtgt ggggccataa caccccagca gatcgctgtg atgacctcag aggagatggc cagtgatgag ctgaaggaga tccgtaaggc catgaccaag gaggccatcc gagagcacca gatggcccgc actggcggca cgcagacaga cctgttcacc tgcggcaagt gcaggaaaaa gaactgcacc tacacacagg tgcagacccg cagctctgat gagcccatga ccacctttgt tgtctgcaac gagtgtggaa accgctggaa gttctgctga. It is sometimes possible for the material contained within the vial of "TCEA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.