Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBRG1 cdna clone

TBRG1 cDNA Clone

Gene Names
TBRG1; NIAM; TB-5
Synonyms
TBRG1; TBRG1 cDNA Clone; TBRG1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAAAAAGCTCCCGAAGAAGAGCCAGAATGAGAAGTACCGGCTGAAGTACCTGCGGCTGCGCAAAGCGGCCAAGGCCACGGTGTTTGAAAATGCTGCTATTTGTGATGAAATTGCTCGTCTTGAGGAAAAATTTCTTAAAGCAAAAGAAGAAAGAAGGTACTTGCTAAAGAAGCTCCTCCAGCTTCAGGCTCTAACTGAAGGGGAAGTACAGGCTGCAGCTCCTTCCCACAGTTCCAGTTTGCCCCTGACTTATGGTGTGGCCAGCTCTGTGGGAACTATACAGGGAGCTGGGCCTATTTCAGGGCCCAGCACTGGGGCTGAGGAACCATTTGGGAAGAAAACTAAGAAGGAGAAAAAAGAAAAAGGCAAAGAGAACAACAAACTGGAAGATCATCACCGACCGACCTGGCTTTCATGA
Sequence Length
420
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,558 Da
NCBI Official Full Name
Homo sapiens transforming growth factor beta regulator 1, mRNA
NCBI Official Synonym Full Names
transforming growth factor beta regulator 1
NCBI Official Symbol
TBRG1
NCBI Official Synonym Symbols
NIAM; TB-5
NCBI Protein Information
transforming growth factor beta regulator 1
UniProt Protein Name
Transforming growth factor beta regulator 1
UniProt Gene Name
TBRG1
UniProt Synonym Gene Names
NIAM
UniProt Entry Name
TBRG1_HUMAN

Uniprot Description

TBRG1: Acts as a growth inhibitor. Can activate p53/TP53, causes G1 arrest and collaborates with CDKN2A to restrict proliferation, but does not require either protein to inhibit DNA synthesis. Redistributes CDKN2A into the nucleoplasm. Involved in maintaining chromosomal stability. Belongs to the TBRG1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: intracellular membrane-bound organelle; nucleus

Molecular Function: protein binding

Biological Process: cell cycle arrest; DNA replication; negative regulation of cell proliferation; nucleolus to nucleoplasm transport; protein stabilization

Research Articles on TBRG1

Similar Products

Product Notes

The TBRG1 tbrg1 (Catalog #AAA1270141) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAAAAGC TCCCGAAGAA GAGCCAGAAT GAGAAGTACC GGCTGAAGTA CCTGCGGCTG CGCAAAGCGG CCAAGGCCAC GGTGTTTGAA AATGCTGCTA TTTGTGATGA AATTGCTCGT CTTGAGGAAA AATTTCTTAA AGCAAAAGAA GAAAGAAGGT ACTTGCTAAA GAAGCTCCTC CAGCTTCAGG CTCTAACTGA AGGGGAAGTA CAGGCTGCAG CTCCTTCCCA CAGTTCCAGT TTGCCCCTGA CTTATGGTGT GGCCAGCTCT GTGGGAACTA TACAGGGAGC TGGGCCTATT TCAGGGCCCA GCACTGGGGC TGAGGAACCA TTTGGGAAGA AAACTAAGAA GGAGAAAAAA GAAAAAGGCA AAGAGAACAA CAAACTGGAA GATCATCACC GACCGACCTG GCTTTCATGA. It is sometimes possible for the material contained within the vial of "TBRG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.