Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBCE cdna clone

TBCE cDNA Clone

Gene Names
TBCE; HRD; KCS; KCS1; pac2
Synonyms
TBCE; TBCE cDNA Clone; TBCE cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgacactttgacagcggatgtcattggtcgaagagttgaagttaatggagaacatgcaacagtacgttttgctggtgttgtccctcccgtggcaggaccctggttaggagtagaatgggacaatcccgagagaggaaagcatgatgggagccacgaagggactgtgtattttaaatgcaggcacccgacaggaggatcctttattcgtccgaacaaggtaaattttggaacagactttcttactgcaattaagaaccgctatgtgttagaagatggaccagaggaagatagaaaagagcaaattgttacaattggaaataaacctgtggagactatcggttttgactctattatgaaacagcaaagtcagctgagcaagttgcaagaagtttctctgaggaactgtgcagtaagttgtgctggtgaaaaaggaggagttgctgaagcatgtcctaatatcagaaaggtagatttgtcaaaaaacctgttgtcatcatgggatgaagtgatacacattgctgatcagctcagacacctggaagtccttaatgtcagtgaaaataaactaaaatttccctccggttcagtattaactggaacgctttctgtactgaaggttttagtcctcaatcaaacaggaataacgtgggctgaggtgctgcggtgtgtcgcggggtgcccaggcctggaggaactctaccttgagtctaacaacattttcatttccgaaaggccaacagatgttctccagacagtcaagttattagatctttcctctaatcaattaattgatgaaaatcagctgtatctgatagcccacctgcccaggttagaacaattaatcctctctgacactggaatttcttctctacattttccggatgctggaattgggtgcaaaacgtccatgttcccatccttgaagtacctggtagtaaacgacaatcagatatcacaatggtcgtttttcaatgagctagagaagttaccaagtctacgggctttgtcctgcctaagaaaccccctgaccaaagaggacaaagaagcagagacggcgcgactactcattatcgccagcattggccagctgaagacgctgaacaaatgtgagattctccccgaggagaggcggagagctgagcttgactaccgaaaagcttttggaaatgagtggaaacaggctggtggacataaggatccggaaaaaaacagactcagcgaagaattcctcacagcccatcccagataccagttcctctgcctgaaatatggtgcacctgaagattgggaactcaaaacacagcaaccacttatgctgaaaaaccagctactaacactgaagataaaataccctcatcaacttgatcagaaagtcctggagaaacaactgccgggctccatgacaattcaaaaggtgaagggattgctgtcacgtcttctcaaagttcctgtgtcagaccttctgttgtcctatgaaagtcccaaaaagccgggcagagaaatcgagctggaaaatgacctaaagtcattacagttttattctgtggaaaatggagattgtctattagtgcgatggtga
Sequence Length
1584
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,852 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor E, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor E
NCBI Official Symbol
TBCE
NCBI Official Synonym Symbols
HRD; KCS; KCS1; pac2
NCBI Protein Information
tubulin-specific chaperone E
UniProt Protein Name
Tubulin-specific chaperone E
UniProt Gene Name
TBCE
UniProt Entry Name
TBCE_HUMAN

NCBI Description

Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

TBCE: Tubulin-folding protein; involved in the second step of the tubulin folding pathway. Seems to be implicated in the maintenance of the neuronal microtubule network. Involved in regulation of tubulin heterodimer dissociation. Defects in TBCE are a cause of hypoparathyroidism- retardation-dysmorphism syndrome (HRD); also known as hypoparathyroidism with short stature, mental retardation, and seizures or Sanjad-Sakati syndrome. HRD is an autosomal recessive disorder reported almost exclusively in Middle Eastern populations. Defects in TBCE are the cause of Kenny-Caffey syndrome type 1 (KCS1). KCS1 is similar to HRD with the additional features of osteosclerosis and recurrent bacterial infections. Belongs to the TBCE family.

Protein type: Chaperone

Chromosomal Location of Human Ortholog: 1q42.3

Cellular Component: microtubule

Molecular Function: chaperone binding

Biological Process: post-chaperonin tubulin folding pathway; protein folding

Disease: Hypoparathyroidism-retardation-dysmorphism Syndrome; Kenny-caffey Syndrome, Type 1

Research Articles on TBCE

Similar Products

Product Notes

The TBCE tbce (Catalog #AAA1274150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaca ctttgacagc ggatgtcatt ggtcgaagag ttgaagttaa tggagaacat gcaacagtac gttttgctgg tgttgtccct cccgtggcag gaccctggtt aggagtagaa tgggacaatc ccgagagagg aaagcatgat gggagccacg aagggactgt gtattttaaa tgcaggcacc cgacaggagg atcctttatt cgtccgaaca aggtaaattt tggaacagac tttcttactg caattaagaa ccgctatgtg ttagaagatg gaccagagga agatagaaaa gagcaaattg ttacaattgg aaataaacct gtggagacta tcggttttga ctctattatg aaacagcaaa gtcagctgag caagttgcaa gaagtttctc tgaggaactg tgcagtaagt tgtgctggtg aaaaaggagg agttgctgaa gcatgtccta atatcagaaa ggtagatttg tcaaaaaacc tgttgtcatc atgggatgaa gtgatacaca ttgctgatca gctcagacac ctggaagtcc ttaatgtcag tgaaaataaa ctaaaatttc cctccggttc agtattaact ggaacgcttt ctgtactgaa ggttttagtc ctcaatcaaa caggaataac gtgggctgag gtgctgcggt gtgtcgcggg gtgcccaggc ctggaggaac tctaccttga gtctaacaac attttcattt ccgaaaggcc aacagatgtt ctccagacag tcaagttatt agatctttcc tctaatcaat taattgatga aaatcagctg tatctgatag cccacctgcc caggttagaa caattaatcc tctctgacac tggaatttct tctctacatt ttccggatgc tggaattggg tgcaaaacgt ccatgttccc atccttgaag tacctggtag taaacgacaa tcagatatca caatggtcgt ttttcaatga gctagagaag ttaccaagtc tacgggcttt gtcctgccta agaaaccccc tgaccaaaga ggacaaagaa gcagagacgg cgcgactact cattatcgcc agcattggcc agctgaagac gctgaacaaa tgtgagattc tccccgagga gaggcggaga gctgagcttg actaccgaaa agcttttgga aatgagtgga aacaggctgg tggacataag gatccggaaa aaaacagact cagcgaagaa ttcctcacag cccatcccag ataccagttc ctctgcctga aatatggtgc acctgaagat tgggaactca aaacacagca accacttatg ctgaaaaacc agctactaac actgaagata aaataccctc atcaacttga tcagaaagtc ctggagaaac aactgccggg ctccatgaca attcaaaagg tgaagggatt gctgtcacgt cttctcaaag ttcctgtgtc agaccttctg ttgtcctatg aaagtcccaa aaagccgggc agagaaatcg agctggaaaa tgacctaaag tcattacagt tttattctgt ggaaaatgga gattgtctat tagtgcgatg gtga. It is sometimes possible for the material contained within the vial of "TBCE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.