Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAX1BP3 cdna clone

TAX1BP3 cDNA Clone

Gene Names
TAX1BP3; TIP1; TIP-1
Synonyms
TAX1BP3; TAX1BP3 cDNA Clone; TAX1BP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcctacatcccgggccagccggtcaccgccgtggtgcaaagagttgaaattcacaagctgcgtcaaggtgagaacttaatcctgggtttcagcattggaggtggaatcgaccaggacccttcccagaatcccttctctgaagacaagacggacaagggtatttatgtcacacgggtgtctgaaggaggccctgctgaaatcgctgggctgcagattggagacaagatcatgcaggtgaacggctgggacatgaccatggtcacacacgaccaggcccgcaagcggctcaccaagcgctcggaggaggtggtgcgtctgctggtgacgcggcagtcgctgcagaaggccgtgcagcagtccatgctgtcctag
Sequence Length
375
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,735 Da
NCBI Official Full Name
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 3, mRNA
NCBI Official Synonym Full Names
Tax1 binding protein 3
NCBI Official Symbol
TAX1BP3
NCBI Official Synonym Symbols
TIP1; TIP-1
NCBI Protein Information
tax1-binding protein 3
UniProt Protein Name
Tax1-binding protein 3
Protein Family
UniProt Gene Name
TAX1BP3
UniProt Synonym Gene Names
TIP-1
UniProt Entry Name
TX1B3_HUMAN

Uniprot Description

TAX1BP3: May regulate a number of protein-protein interactions by competing for PDZ domain binding sites. Binds CTNNB1 and may thereby act as an inhibitor of the Wnt signaling pathway. Competes with LIN7A for KCNJ4 binding, and thereby promotes KCNJ4 internalization. May play a role in the Rho signaling pathway. May play a role in activation of CDC42 by the viral protein HPV16 E6.

Protein type: Adaptor/scaffold; Cell cycle regulation

Chromosomal Location of Human Ortholog: 17p13

Cellular Component: cytosol

Molecular Function: protein binding; protein C-terminus binding

Biological Process: negative regulation of Wnt receptor signaling pathway; Rho protein signal transduction

Research Articles on TAX1BP3

Similar Products

Product Notes

The TAX1BP3 tax1bp3 (Catalog #AAA1277818) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctaca tcccgggcca gccggtcacc gccgtggtgc aaagagttga aattcacaag ctgcgtcaag gtgagaactt aatcctgggt ttcagcattg gaggtggaat cgaccaggac ccttcccaga atcccttctc tgaagacaag acggacaagg gtatttatgt cacacgggtg tctgaaggag gccctgctga aatcgctggg ctgcagattg gagacaagat catgcaggtg aacggctggg acatgaccat ggtcacacac gaccaggccc gcaagcggct caccaagcgc tcggaggagg tggtgcgtct gctggtgacg cggcagtcgc tgcagaaggc cgtgcagcag tccatgctgt cctag. It is sometimes possible for the material contained within the vial of "TAX1BP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.