SYNPR cdna clone
SYNPR cDNA Clone
Gene Names
SYNPR; SPO
Synonyms
SYNPR; SYNPR cDNA Clone; SYNPR cdna clone
Sequence
atgtgtatggtgatatttgctccgctttttgcaatctttgcatttgcaacatgcggtggctattctggaggcctgcggctgagtgtggactgcgtcaacaagacagaaagtaacctcagcatcgacatagcgtttgcctacccattcaggttgcaccaggtgacgtttgaggtgcccacctgcgagggaaaggaacggcagaagctggcattgattggtgactcctcgtcttcagcagagttcttcgtcactgttgctgtcttcgccttcctctactctttggctgccactgtcgtttacattttcttccagaacaaataccgggaaaacaaccggggcccactcattgacttcattgtcactgtagtcttttcgttcttgtggttggtgggttcatcagcttgggcaaaaggactgtctgacgtcaaagttgcaacggatcccaaggaagtattgctactaatgtcagcttgcaaacagccatccaacaaatgcatggctatccacagccctgttatgtcaagcttaaacacttctgtggtctttggattcttgaactttattctctgggctggaaacatatggtttgttttcaaggagaccggctggcattcttcgggacagagatatctttcagatccaatggagaagcactccagcagctataatcaaggtggttacaaccaagacagctatggatcaagcagtgggtacagtcagcaggcgagtttggggccaacctcagatgagtttggccaacagcctactggccccacttcctttaccaatcagatttaa
Sequence Length
798
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,329 Da
NCBI Official Full Name
Homo sapiens synaptoporin, mRNA
NCBI Official Synonym Full Names
synaptoporin
NCBI Official Symbol
SYNPR
NCBI Official Synonym Symbols
SPO
NCBI Protein Information
synaptoporin
UniProt Protein Name
Synaptoporin
Protein Family
UniProt Gene Name
SYNPR
UniProt Entry Name
SYNPR_HUMAN
Uniprot Description
SYNPR: Intrinsic membrane protein of small synaptic vesicles. Probable vesicular channel protein. Belongs to the synaptophysin/synaptobrevin family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 3p14.2
Cellular Component: integral to synaptic vesicle membrane
Molecular Function: protein binding
Research Articles on SYNPR
Similar Products
Product Notes
The SYNPR synpr (Catalog #AAA1271721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtatgg tgatatttgc tccgcttttt gcaatctttg catttgcaac atgcggtggc tattctggag gcctgcggct gagtgtggac tgcgtcaaca agacagaaag taacctcagc atcgacatag cgtttgccta cccattcagg ttgcaccagg tgacgtttga ggtgcccacc tgcgagggaa aggaacggca gaagctggca ttgattggtg actcctcgtc ttcagcagag ttcttcgtca ctgttgctgt cttcgccttc ctctactctt tggctgccac tgtcgtttac attttcttcc agaacaaata ccgggaaaac aaccggggcc cactcattga cttcattgtc actgtagtct tttcgttctt gtggttggtg ggttcatcag cttgggcaaa aggactgtct gacgtcaaag ttgcaacgga tcccaaggaa gtattgctac taatgtcagc ttgcaaacag ccatccaaca aatgcatggc tatccacagc cctgttatgt caagcttaaa cacttctgtg gtctttggat tcttgaactt tattctctgg gctggaaaca tatggtttgt tttcaaggag accggctggc attcttcggg acagagatat ctttcagatc caatggagaa gcactccagc agctataatc aaggtggtta caaccaagac agctatggat caagcagtgg gtacagtcag caggcgagtt tggggccaac ctcagatgag tttggccaac agcctactgg ccccacttcc tttaccaatc agatttaa. It is sometimes possible for the material contained within the vial of "SYNPR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
