Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SWAP70 cdna clone

SWAP70 cDNA Clone

Gene Names
SWAP70; HSPC321; SWAP-70
Synonyms
SWAP70; SWAP70 cDNA Clone; SWAP70 cdna clone
Ordering
For Research Use Only!
Sequence
atggggagcttgaaggaggagctgctcaaagccatctggcacgccttcaccgcactcgaccaggaccacagcggcaaggtctccaagtcccagctcaaggtcctttcccataacctgtgcacggtgctgaaggttcctcatgacccagttgcccttgaagagcacttcagggatgatgatgagggtccagtgtccaaccagggctacatgccttatttaaacaggttcattttggaaaaggtccaagacaactttgacaagattgaattcaataggatgtgttggaccctctgtgtcaaaaaaaacctcacaaagaatcccctgctcattacagaagaagatgcatttaaaatatgggttattttcaactttttatctgaggacaagtatccattaattattgtgtcagaagagattgaatacctgcttaagaagcttacagaagctatgggaggaggttggcagcaagaacaatttgaacattataaaatcaactttgatgacagtaaaaatggcctttctgcatgggaacttattgagcttattggaaatggacagtttagcaaaggcatggaccggcagactgtgtctatggcaattaatgaagtctttaatgaacttatattagatgtgttaaagcagggttacatgatgaaaaagggccacagacggaaaaactggactgaaagatggtttgtactaaaacccaacataatttcttactatgtgagtgaggatctgaaggataagaaaggagacattctcttggatgaaaattgctgtgtagagtccttgcctgacaaagatggaaagaaatgcctttttctcgtaaaatgttttgataagacttttgaaatcagtgcttcagataagaagaagaaacaggagtggattcaagccattcattctactattcatctgttgaagctgggcagccctccaccacacaaagaagcccgccagcgtcggaaagaactccggaagaagcagctggctgaacaagaggaactggagcgacaaatgaaggaactccaggccgccaacgaaagcaagcagcaggagctggaggccgtgcggaagaaactggaggaagcagcatctcgtgcagcagaagaggaaaagaaacgccttcagactcaagtggaacttcaggccaggttcagcacagagctggaaagagagaagcttatcagacagcagatggaagaacaggttgctcaaaagtcctctgaactggaacagtatttacagcgagtacgggagctggaagacatgtacctaaagctgcaggaggctcttgaagatgagagacaggcccggcaagatgaagagacagtgcggaagcttcaggccaggttgttggaggaagagtcttccaagagggctgaactagaaaagtggcacttggagcagcagcaggccattcagacaaccgaggcggagaagcaggagttggagaatcagcgtgtcctgaaggaacaggccctgcaggaggccatggagcagctggagcagcttgagttagaacggaagcaagcacttgagcagtacgaggaagttaaaaagaagctggagatggcaactaataagaccaagagctggaaggacaaagtggcccatcatgaaggattaattcgactgatagaaccaggttcaaagaaccctcacctgatcactaactggggacctgcagctttcactgaggcagaacttgaagagagagagaagaactggaaagagaaaaagaccacggagtga
Sequence Length
1758
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,998 Da
NCBI Official Full Name
Homo sapiens SWAP-70 protein, mRNA
NCBI Official Synonym Full Names
SWAP switching B-cell complex 70kDa subunit
NCBI Official Symbol
SWAP70
NCBI Official Synonym Symbols
HSPC321; SWAP-70
NCBI Protein Information
switch-associated protein 70
UniProt Protein Name
Switch-associated protein 70
Protein Family
UniProt Gene Name
SWAP70
UniProt Synonym Gene Names
KIAA0640; SWAP-70
UniProt Entry Name
SWP70_HUMAN

Uniprot Description

SWAP-70: Phosphatidylinositol 3,4,5-trisphosphate-dependent guanine nucleotide exchange factor (GEF) which, independently of RAS, transduces signals from tyrosine kinase receptors to RAC. It also mediates signaling of membrane ruffling. Regulates the actin cytoskeleton as an effector or adapter protein in response to agonist stimulated phosphatidylinositol (3,4)-bisphosphate production and cell protrusion.

Protein type: GEFs, Rac/Rho; GEFs

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: cell-cell adherens junction; cytoplasm

Molecular Function: protein binding

Research Articles on SWAP70

Similar Products

Product Notes

The SWAP70 swap70 (Catalog #AAA1277383) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagct tgaaggagga gctgctcaaa gccatctggc acgccttcac cgcactcgac caggaccaca gcggcaaggt ctccaagtcc cagctcaagg tcctttccca taacctgtgc acggtgctga aggttcctca tgacccagtt gcccttgaag agcacttcag ggatgatgat gagggtccag tgtccaacca gggctacatg ccttatttaa acaggttcat tttggaaaag gtccaagaca actttgacaa gattgaattc aataggatgt gttggaccct ctgtgtcaaa aaaaacctca caaagaatcc cctgctcatt acagaagaag atgcatttaa aatatgggtt attttcaact ttttatctga ggacaagtat ccattaatta ttgtgtcaga agagattgaa tacctgctta agaagcttac agaagctatg ggaggaggtt ggcagcaaga acaatttgaa cattataaaa tcaactttga tgacagtaaa aatggccttt ctgcatggga acttattgag cttattggaa atggacagtt tagcaaaggc atggaccggc agactgtgtc tatggcaatt aatgaagtct ttaatgaact tatattagat gtgttaaagc agggttacat gatgaaaaag ggccacagac ggaaaaactg gactgaaaga tggtttgtac taaaacccaa cataatttct tactatgtga gtgaggatct gaaggataag aaaggagaca ttctcttgga tgaaaattgc tgtgtagagt ccttgcctga caaagatgga aagaaatgcc tttttctcgt aaaatgtttt gataagactt ttgaaatcag tgcttcagat aagaagaaga aacaggagtg gattcaagcc attcattcta ctattcatct gttgaagctg ggcagccctc caccacacaa agaagcccgc cagcgtcgga aagaactccg gaagaagcag ctggctgaac aagaggaact ggagcgacaa atgaaggaac tccaggccgc caacgaaagc aagcagcagg agctggaggc cgtgcggaag aaactggagg aagcagcatc tcgtgcagca gaagaggaaa agaaacgcct tcagactcaa gtggaacttc aggccaggtt cagcacagag ctggaaagag agaagcttat cagacagcag atggaagaac aggttgctca aaagtcctct gaactggaac agtatttaca gcgagtacgg gagctggaag acatgtacct aaagctgcag gaggctcttg aagatgagag acaggcccgg caagatgaag agacagtgcg gaagcttcag gccaggttgt tggaggaaga gtcttccaag agggctgaac tagaaaagtg gcacttggag cagcagcagg ccattcagac aaccgaggcg gagaagcagg agttggagaa tcagcgtgtc ctgaaggaac aggccctgca ggaggccatg gagcagctgg agcagcttga gttagaacgg aagcaagcac ttgagcagta cgaggaagtt aaaaagaagc tggagatggc aactaataag accaagagct ggaaggacaa agtggcccat catgaaggat taattcgact gatagaacca ggttcaaaga accctcacct gatcactaac tggggacctg cagctttcac tgaggcagaa cttgaagaga gagagaagaa ctggaaagag aaaaagacca cggagtga. It is sometimes possible for the material contained within the vial of "SWAP70, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.