SV2B cdna clone
SV2B cDNA Clone
Gene Names
SV2B; HsT19680
Synonyms
SV2B; SV2B cDNA Clone; SV2B cdna clone
Sequence
atggatgactacaagtatcaggacaattatgggggctatgctcccagtgatggctattaccgcggcaatgagtccaacccagaagaagatgcacagagtgatgtcaccgaaggccatgatgaggaagacgagatctatgagggcgagtaccagggtatccctcacccagatgatgtcaaggccaagcaggccaagatggcgccctccagaatggacagccttcggggccagacagacctgatggctgagaggctggaagatgaggagcagttggcccatcagtacgagaccatcatggatgagtgtggccatggccgcttccagtggatcctctttttcgtcttgggtttggccctgatggccgatggggtggaagtgttcgtggtgagttttgccctgcccagtgcagagaaggacatgtgtctgtccagttccaaaaaaggaatgctagggatgatagtctacttgggaatgatggcgggcgccttcatcctgggaggcctggctgataagctgggaaggaagcgagtcctcagcatgtctctggccgtcaatgcctccttcgcctccctctcttccttcgtgcagggatatggagccttcctcttctgccgactcatctcaggcatcggtattgggggtgctctaccgattgtttttgcctatttttctgaattcttgtctcgggagaagcgaggagaacacctcagttggctgggcatcttctggatgactgggggcctgtacgcatctgccatggcctggagcatcatcccacactatggctggggcttcagcatggggaccaattaccacttccatagctggagagtgtttgtcatcgtctgtgctctgccctgcaccgtgtccatggtggccctgaagttcatgccagagagcccaaggtttctgctagagatgggcaaacatgatgaagcctggatgattctcaagcaagtccatgacaccaacatgagagctaaggggaccccagagaaagtgttcacggtttccaacatcaaaactcccaagcaaatggatgaattcattgagatccaaagttcaacaggaacctggtaccagcgctggctggtcagattcaagaccattttcaagcaggtctgggataatgccctgtactgtgtgatggggccctacagaatgaatacactgattctggccgtggtttggtttgccatggcattcagttactatggactgacagtttggtttcctgatatgatccgctattttcaagatgaagaatacaagtctaaaatgaaggtgttttttggtgagcatgtgtacggcgccacaatcaacttcacgatggaaaatcagatccaccaacatgggaaacttgtgaatgataagttcacaagaatgtactttaaacatgtactctttgaggacacattctttgacgagtgctattttgaagacgtaacatcaacagatacctacttcaaaaattgtaccattgaatcaaccatcttttacaacacagacctctacgagcacaagttcatcaactgtcggtttatcaactccaccttcctggagcagaaggagggctgccacatggacttggagcaagataatgacttcctgatttacctcgtcagcttcctgggcagcctgtctgtcttacccgggaacatcatttctgccctgctcatggatagaattggaaggctcaagatgattggtggctccatgctaatctctgcagtctgctgcttcttcctgttttttggcaacagtgagtctgcaatgatcggctggcagtgcctgttctgtgggacaagcattgcagcctggaatgctctggatgtgatcacagtggagctgtatcccaccaaccagagagcaacagccttcggcattctcaatggattatgcaaatttggcgccatcctgggaaacaccatctttgcttcttttgttgggataaccaaagtggtccccatccttctggctgctgcttctctggttgggggtggcctgattgcccttcgactgccagagactcgagaacaggtcctgatgtga
Sequence Length
2052
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,439 Da
NCBI Official Full Name
Homo sapiens synaptic vesicle glycoprotein 2B, mRNA
NCBI Official Synonym Full Names
synaptic vesicle glycoprotein 2B
NCBI Official Symbol
SV2B
NCBI Official Synonym Symbols
HsT19680
NCBI Protein Information
synaptic vesicle glycoprotein 2B
UniProt Protein Name
Synaptic vesicle glycoprotein 2B
Protein Family
UniProt Gene Name
SV2B
UniProt Synonym Gene Names
KIAA0735
UniProt Entry Name
SV2B_HUMAN
Uniprot Description
SV2B: Probably plays a role in the control of regulated secretion in neural and endocrine cells. Belongs to the major facilitator superfamily.
Protein type: Membrane protein, integral; Vesicle; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 15q26.1
Cellular Component: membrane; plasma membrane; synaptic vesicle; synaptic vesicle membrane
Molecular Function: protein binding
Research Articles on SV2B
Similar Products
Product Notes
The SV2B sv2b (Catalog #AAA1267350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgact acaagtatca ggacaattat gggggctatg ctcccagtga tggctattac cgcggcaatg agtccaaccc agaagaagat gcacagagtg atgtcaccga aggccatgat gaggaagacg agatctatga gggcgagtac cagggtatcc ctcacccaga tgatgtcaag gccaagcagg ccaagatggc gccctccaga atggacagcc ttcggggcca gacagacctg atggctgaga ggctggaaga tgaggagcag ttggcccatc agtacgagac catcatggat gagtgtggcc atggccgctt ccagtggatc ctctttttcg tcttgggttt ggccctgatg gccgatgggg tggaagtgtt cgtggtgagt tttgccctgc ccagtgcaga gaaggacatg tgtctgtcca gttccaaaaa aggaatgcta gggatgatag tctacttggg aatgatggcg ggcgccttca tcctgggagg cctggctgat aagctgggaa ggaagcgagt cctcagcatg tctctggccg tcaatgcctc cttcgcctcc ctctcttcct tcgtgcaggg atatggagcc ttcctcttct gccgactcat ctcaggcatc ggtattgggg gtgctctacc gattgttttt gcctattttt ctgaattctt gtctcgggag aagcgaggag aacacctcag ttggctgggc atcttctgga tgactggggg cctgtacgca tctgccatgg cctggagcat catcccacac tatggctggg gcttcagcat ggggaccaat taccacttcc atagctggag agtgtttgtc atcgtctgtg ctctgccctg caccgtgtcc atggtggccc tgaagttcat gccagagagc ccaaggtttc tgctagagat gggcaaacat gatgaagcct ggatgattct caagcaagtc catgacacca acatgagagc taaggggacc ccagagaaag tgttcacggt ttccaacatc aaaactccca agcaaatgga tgaattcatt gagatccaaa gttcaacagg aacctggtac cagcgctggc tggtcagatt caagaccatt ttcaagcagg tctgggataa tgccctgtac tgtgtgatgg ggccctacag aatgaataca ctgattctgg ccgtggtttg gtttgccatg gcattcagtt actatggact gacagtttgg tttcctgata tgatccgcta ttttcaagat gaagaataca agtctaaaat gaaggtgttt tttggtgagc atgtgtacgg cgccacaatc aacttcacga tggaaaatca gatccaccaa catgggaaac ttgtgaatga taagttcaca agaatgtact ttaaacatgt actctttgag gacacattct ttgacgagtg ctattttgaa gacgtaacat caacagatac ctacttcaaa aattgtacca ttgaatcaac catcttttac aacacagacc tctacgagca caagttcatc aactgtcggt ttatcaactc caccttcctg gagcagaagg agggctgcca catggacttg gagcaagata atgacttcct gatttacctc gtcagcttcc tgggcagcct gtctgtctta cccgggaaca tcatttctgc cctgctcatg gatagaattg gaaggctcaa gatgattggt ggctccatgc taatctctgc agtctgctgc ttcttcctgt tttttggcaa cagtgagtct gcaatgatcg gctggcagtg cctgttctgt gggacaagca ttgcagcctg gaatgctctg gatgtgatca cagtggagct gtatcccacc aaccagagag caacagcctt cggcattctc aatggattat gcaaatttgg cgccatcctg ggaaacacca tctttgcttc ttttgttggg ataaccaaag tggtccccat ccttctggct gctgcttctc tggttggggg tggcctgatt gcccttcgac tgccagagac tcgagaacag gtcctgatgt ga. It is sometimes possible for the material contained within the vial of "SV2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
