Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SULT1C2 cdna clone

SULT1C2 cDNA Clone

Gene Names
SULT1C2; ST1C1; ST1C2; SULT1C1; humSULTC2
Synonyms
SULT1C2; SULT1C2 cDNA Clone; SULT1C2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgacctcagacctggggaaacagataaaactgaaagaggtggaggggaccctcctgcagcctgcaactgtggacaactggagccagatccagagcttcgaggccaaaccagatgatctcctcatctgcacctaccctaaagcagggacaacgtggattcaggaaattgtggatatgattgaacagaatggggacgtggagaagtgccagcgagccatcatccaacaccgccatcctttcattgagtgggctcggccaccccaaccttctggtgtggaaaaagccaaagcaatgccctctccacggatactaaagactcacctttccactcagctgctgccaccgtctttctgggaaaacaactgcaagttcctttatgtagctcgaaatgccaaagactgtatggtttcctactaccatttccaaaggatgaaccacatgcttcctgaccctggtacctgggaagagtattttgaaaccttcatcaatggaaaagtggtttggggttcctggtttgaccacgtgaaaggatggtgggagatgaaagacagacaccagattctcttcctcttctatgaggacataaagagggacccaaagcatgaaattcggaaggtgatgcagttcatgggaaagaaggtggatgaaacagtgctagataaaattgtccaggagacgtcatttgagaaaatgaaagaaaatcccatgacaaatcgttctacagtttccaaatctatcttggaccagtcaatttcctccttcatgagaaaaggaactgtgggggattggaaaaaccacttcactgttgcccagaatgagaggtttgatgaaatctatagaagaaagatggaaggaacctccataaacttctgcatggaactctga
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,868 Da
NCBI Official Full Name
Homo sapiens sulfotransferase family, cytosolic, 1C, member 2, mRNA
NCBI Official Synonym Full Names
sulfotransferase family 1C member 2
NCBI Official Symbol
SULT1C2
NCBI Official Synonym Symbols
ST1C1; ST1C2; SULT1C1; humSULTC2
NCBI Protein Information
sulfotransferase 1C2
UniProt Protein Name
Sulfotransferase 1C2
Protein Family
UniProt Gene Name
SULT1C2
UniProt Synonym Gene Names
SULT1C1; ST1C2; SULT1C#1
UniProt Entry Name
ST1C2_HUMAN

NCBI Description

Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SULT1C1: Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of drugs, xenobiotic compounds, hormones, and neurotransmitters. May be involved in the activation of carcinogenic hyroxylamines. Shows activity towards p-nitrophenol and N-hydroxy-2-acetylamino-fluorene (N-OH-2AAF). Belongs to the sulfotransferase 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.8.2.-

Chromosomal Location of Human Ortholog: 2q12.3

Cellular Component: cytoplasm; cytosol

Molecular Function: aryl sulfotransferase activity; protein binding; sulfotransferase activity

Biological Process: 3'-phosphoadenosine 5'-phosphosulfate metabolic process; amine metabolic process; sulfation

Research Articles on SULT1C2

Similar Products

Product Notes

The SULT1C2 sult1c2 (Catalog #AAA1266008) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctga cctcagacct ggggaaacag ataaaactga aagaggtgga ggggaccctc ctgcagcctg caactgtgga caactggagc cagatccaga gcttcgaggc caaaccagat gatctcctca tctgcaccta ccctaaagca gggacaacgt ggattcagga aattgtggat atgattgaac agaatgggga cgtggagaag tgccagcgag ccatcatcca acaccgccat cctttcattg agtgggctcg gccaccccaa ccttctggtg tggaaaaagc caaagcaatg ccctctccac ggatactaaa gactcacctt tccactcagc tgctgccacc gtctttctgg gaaaacaact gcaagttcct ttatgtagct cgaaatgcca aagactgtat ggtttcctac taccatttcc aaaggatgaa ccacatgctt cctgaccctg gtacctggga agagtatttt gaaaccttca tcaatggaaa agtggtttgg ggttcctggt ttgaccacgt gaaaggatgg tgggagatga aagacagaca ccagattctc ttcctcttct atgaggacat aaagagggac ccaaagcatg aaattcggaa ggtgatgcag ttcatgggaa agaaggtgga tgaaacagtg ctagataaaa ttgtccagga gacgtcattt gagaaaatga aagaaaatcc catgacaaat cgttctacag tttccaaatc tatcttggac cagtcaattt cctccttcat gagaaaagga actgtggggg attggaaaaa ccacttcact gttgcccaga atgagaggtt tgatgaaatc tatagaagaa agatggaagg aacctccata aacttctgca tggaactctg a. It is sometimes possible for the material contained within the vial of "SULT1C2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.