Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STUB1 cdna clone

STUB1 cDNA Clone

Gene Names
STUB1; CHIP; UBOX1; SCAR16; HSPABP2; NY-CO-7; SDCCAG7
Synonyms
STUB1; STUB1 cDNA Clone; STUB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagggcaaggaggagaaggagggcggcgcacggctgggcgctggcggcggaagccccgagaagagcccgagcgcgcaggagctcaaggagcagggcaatcgtctgttcgtgggccgaaagtacccggaggcggcggcctgctacggccgcgcgatcacccggaacccgctggtggccgtgtattacaccaaccgggccttgtgctacctgaagatgcagcagcacgagcaggccctggccgactgccggcgcgccctggagctggacgggcagtctgtgaaggcgcacttcttcctggggcagtgccagctggagatggagagctatgatgaggccatcgccaatctgcagcgagcttacagcctggccaaggagcagcggctgaacttcggggacgacatccccagcgctcttcgaatcgcgaagaagaagcgctggaacagcattgaggagcggcgcatccaccaggagagcgagctgcactcctacctctccaggctcattgccgcggagcgtgagagggagctggaagagtgccagcgaaaccacgagggtgatgaggacgacagccacgtccgggcccagcaggcctgcattgaggccaagcacgacaagtacatggcggacatggacgagcttttttctcaggtggatgagaagaggaagaagcgagacatccccgactacctgtgtggcaagatcagctttgagctgatgcgggagccgtgcatcacgcccagtggcatcacctacgaccgcaaggacatcgaggagcacctgcagcgtgtgggtcattttgaccccgtgacccggagccccctgacccaggaacagctcatccccaacttggctatgaaggaggttattgacgcattcatctctgagaatggctgggtggaggactactga
Sequence Length
912
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,067 Da
NCBI Official Full Name
Homo sapiens STIP1 homology and U-box containing protein 1, mRNA
NCBI Official Synonym Full Names
STIP1 homology and U-box containing protein 1
NCBI Official Symbol
STUB1
NCBI Official Synonym Symbols
CHIP; UBOX1; SCAR16; HSPABP2; NY-CO-7; SDCCAG7
NCBI Protein Information
E3 ubiquitin-protein ligase CHIP
UniProt Protein Name
E3 ubiquitin-protein ligase CHIP
UniProt Gene Name
STUB1
UniProt Entry Name
CHIP_HUMAN

NCBI Description

This gene encodes a protein containing tetratricopeptide repeat and a U-box that functions as a ubiquitin ligase/cochaperone. The encoded protein binds to and ubiquitinates shock cognate 71 kDa protein (Hspa8) and DNA polymerase beta (Polb), among other targets. Mutations in this gene cause spinocerebellar ataxia, autosomal recessive 16. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 2. [provided by RefSeq, Jun 2014]

Uniprot Description

CHIP: E3 ubiquitin-protein ligase which targets misfolded chaperone substrates towards proteasomal degradation. Collaborates with ATXN3 in the degradation of misfolded chaperone substrates: ATXN3 restricting the length of ubiquitin chain attached to STUB1/CHIP substrates and preventing further chain extension. Ubiquitinates NOS1 in concert with Hsp70 and Hsp40. Modulates the activity of several chaperone complexes, including Hsp70, Hsc70 and Hsp90. Mediates transfer of non-canonical short ubiquitin chains to HSPA8 that have no effect on HSPA8 degradation. Mediates polyubiquitination of DNA polymerase beta (POLB) at 'Lys-41', 'Lys-61' and 'Lys-81', thereby playing a role in base-excision repair: catalyzes polyubiquitination by amplifying the HUWE1/ARF- BP1-dependent monoubiquitination and leading to POLB-degradation by the proteasome. Mediates polyubiquitination of CYP3A4. Ubiquitinates EPHA2 and may regulate the receptor stability and activity through proteasomal degradation. Homodimer. Interacts with BAG2, and with the E2 ubiquitin conjugating enzymes UBE2D1, UBE2D2 and UBE2D3. Interacts with the C-terminal domains of HSPA8 and HSPA1A. Detected in a ternary complex containing STUB1, HSPA1A and HSPBP1. Interacts with MKKS. Interacts with DYX1C1 and POLB. Interacts (via TPR repeats) with HSP90AA1. Interacts (when monoubiquitinated) with ATXN3. Interacts with UBE2W. Interacts (via the U-box domain) with the UBE2V2- UBE2N heterodimer; the complex has a specific 'Lys-63'-linked polyubiquitination activity. Interacts with DNAJB6. Highly expressed in skeletal muscle, heart, pancreas, brain and placenta. Detected in kidney, liver and lung. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Adaptor/scaffold; EC 6.3.2.-; EC 6.3.2.19; Ligase; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; intermediate filament cytoskeleton; nuclear inclusion body; nucleoplasm; plasma membrane; ubiquitin conjugating enzyme complex; ubiquitin ligase complex

Molecular Function: enzyme binding; G-protein-coupled receptor binding; Hsp70 protein binding; Hsp90 protein binding; kinase binding; misfolded protein binding; protein binding; protein binding, bridging; protein homodimerization activity; SMAD binding; TPR domain binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: misfolded or incompletely synthesized protein catabolic process; negative regulation of transforming growth factor beta receptor signaling pathway; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of protein ubiquitination; proteasomal ubiquitin-dependent protein catabolic process; protein autoubiquitination; protein maturation; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of glucocorticoid metabolic process; regulation of protein stability; ubiquitin-dependent protein catabolic process; ubiquitin-dependent SMAD protein catabolic process

Disease: Spinocerebellar Ataxia, Autosomal Recessive 16

Research Articles on STUB1

Similar Products

Product Notes

The STUB1 stub1 (Catalog #AAA1277291) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagggca aggaggagaa ggagggcggc gcacggctgg gcgctggcgg cggaagcccc gagaagagcc cgagcgcgca ggagctcaag gagcagggca atcgtctgtt cgtgggccga aagtacccgg aggcggcggc ctgctacggc cgcgcgatca cccggaaccc gctggtggcc gtgtattaca ccaaccgggc cttgtgctac ctgaagatgc agcagcacga gcaggccctg gccgactgcc ggcgcgccct ggagctggac gggcagtctg tgaaggcgca cttcttcctg gggcagtgcc agctggagat ggagagctat gatgaggcca tcgccaatct gcagcgagct tacagcctgg ccaaggagca gcggctgaac ttcggggacg acatccccag cgctcttcga atcgcgaaga agaagcgctg gaacagcatt gaggagcggc gcatccacca ggagagcgag ctgcactcct acctctccag gctcattgcc gcggagcgtg agagggagct ggaagagtgc cagcgaaacc acgagggtga tgaggacgac agccacgtcc gggcccagca ggcctgcatt gaggccaagc acgacaagta catggcggac atggacgagc ttttttctca ggtggatgag aagaggaaga agcgagacat ccccgactac ctgtgtggca agatcagctt tgagctgatg cgggagccgt gcatcacgcc cagtggcatc acctacgacc gcaaggacat cgaggagcac ctgcagcgtg tgggtcattt tgaccccgtg acccggagcc ccctgaccca ggaacagctc atccccaact tggctatgaa ggaggttatt gacgcattca tctctgagaa tggctgggtg gaggactact ga. It is sometimes possible for the material contained within the vial of "STUB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.