Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STK25 cdna clone

STK25 cDNA Clone

Gene Names
STK25; SOK1; YSK1
Synonyms
STK25; STK25 cDNA Clone; STK25 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatgagatcgaggacatccagcaggagatcactgtcctcagtcagtgcgacagcccctacatcacccgctactttggctcctacctaaagagcaccaagctatggatcatcatggagtacctgggcggcggctcagcactggacttgcttaaaccaggtcccctggaggagacatacattgccacgatcctgcgggagattctgaagggcctggattatctgcactccgaacgcaagatccaccgagacatcaaagctgccaacgtgctactctcggagcagggtgacgtgaagctggcggactttggggtagcagggcagctcacagacacgcagattaagaggaacacattcgtgggcacccccttctggatggcacctgaggtcatcaagcagtcggcctacgacttcaaggctgacatctggtccctggggatcacagccatcgagctggccaagggggagcctccaaactctgacctccaccccatgcgcgtcctgttcctgattcccaagaacagcccacccacactggagggccagcacagcaagcccttcaaggagttcgtggaggcctgcctcaacaaagacccccgattccggcccacggccaaggagctcctgaagcacaagttcatcacacgctacaccaagaagacctccttcctcacggagctcatcgaccgctataagcgctggaagtcagaggggcatggcgaggagtccagctctgaggactctgacattgatggcgaggcggaggacggggagcagggccccatctggacgttcccccctaccatccggccgagtccacacagcaagcttcacaaggggacggccctgcacagttcacagaagcctgcggagcccgtcaagaggcagccgaggtcccagtgcctgtccacgctggtccggcccgtcttcggagagctcaaagagaagcacaagcagagcggcgggagcgtgggtgcgctggaggagctggagaacgccttcagcctggccgaggagtcctgccccggcatctcagacaagctgatggtgcacctggtggagcgagtgcagaggttttcacacaacagaaaccacctgacatccacccgctga
Sequence Length
1281
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,297 Da
NCBI Official Full Name
Homo sapiens serine/threonine kinase 25 (STE20 homolog, yeast), mRNA
NCBI Official Synonym Full Names
serine/threonine kinase 25
NCBI Official Symbol
STK25
NCBI Official Synonym Symbols
SOK1; YSK1
NCBI Protein Information
serine/threonine-protein kinase 25
UniProt Protein Name
Serine/threonine-protein kinase 25
UniProt Gene Name
STK25
UniProt Synonym Gene Names
SOK1; YSK1; SOK-1; Ste20/oxidant stress response kinase 1
UniProt Entry Name
STK25_HUMAN

NCBI Description

This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]

Uniprot Description

YSK1: Oxidant stress-activated serine/threonine kinase that may play a role in the response to environmental stress. Targets to the Golgi apparatus where it appears to regulate protein transport events, cell adhesion, and polarity complexes important for cell migration. Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. STE20 subfamily.

Protein type: Protein kinase, STE; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; STE group; STE20 family; YSK subfamily

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: cytoplasm; Golgi apparatus

Molecular Function: protein binding; protein homodimerization activity; protein kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: establishment of Golgi localization; Golgi localization; positive regulation of stress-activated MAPK cascade; protein amino acid autophosphorylation; protein amino acid phosphorylation; response to hydrogen peroxide; response to oxidative stress; signal transduction

Research Articles on STK25

Similar Products

Product Notes

The STK25 stk25 (Catalog #AAA1269643) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcacc tccggggatt tgccaaccag cactctcgag tggaccctga ggagctcttc accaagctcg accgcattgg caagggctcg tttggggagg tctacaaggg catcgataac cacacaaagg aggtggtggc catcaagatc atcgacctgg aggaggccga ggatgagatc gaggacatcc agcaggagat cactgtcctc agtcagtgcg acagccccta catcacccgc tactttggct cctacctaaa gagcaccaag ctatggatca tcatggagta cctgggcggc ggctcagcac tggacttgct taaaccaggt cccctggagg agacatacat tgccacgatc ctgcgggaga ttctgaaggg cctggattat ctgcactccg aacgcaagat ccaccgagac atcaaagctg ccaacgtgct actctcggag cagggtgacg tgaagctggc ggactttggg gtagcagggc agctcacaga cacgcagatt aagaggaaca cattcgtggg cacccccttc tggatggcac ctgaggtcat caagcagtcg gcctacgact tcaaggctga catctggtcc ctggggatca cagccatcga gctggccaag ggggagcctc caaactctga cctccacccc atgcgcgtcc tgttcctgat tcccaagaac agcccaccca cactggaggg ccagcacagc aagcccttca aggagttcgt ggaggcctgc ctcaacaaag acccccgatt ccggcccacg gccaaggagc tcctgaagca caagttcatc acacgctaca ccaagaagac ctccttcctc acggagctca tcgaccgcta taagcgctgg aagtcagagg ggcatggcga ggagtccagc tctgaggact ctgacattga tggcgaggcg gaggacgggg agcagggccc catctggacg ttccccccta ccatccggcc gagtccacac agcaagcttc acaaggggac ggccctgcac agttcacaga agcctgcgga gcccgtcaag aggcagccga ggtcccagtg cctgtccacg ctggtccggc ccgtcttcgg agagctcaaa gagaagcaca agcagagcgg cgggagcgtg ggtgcgctgg aggagctgga gaacgccttc agcctggccg aggagtcctg ccccggcatc tcagacaagc tgatggtgca cctggtggag cgagtgcaga ggttttcaca caacagaaac cacctgacat ccacccgctg a. It is sometimes possible for the material contained within the vial of "STK25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.