STAG3L1 cdna clone
STAG3L1 cDNA Clone
Gene Names
STAG3L1; STAG3L2; STAG3L3; STAG3L1P
Synonyms
STAG3L1; STAG3L1 cDNA Clone; STAG3L1 cdna clone
Sequence
atgggtggaagagagcaacgccagagcccaggtgcccagaggactttcttccagcttctgctgtccttctttgtggagagcaagctccacgaccacgctgcttacttagtagacaacctgtgggactgtgcagggactcagctgaaggactgggagggtctgacaagcctgctgctggagaaggaccagagcacgtgccacatggagccagggccagggaccttccacctcctagggtga
Sequence Length
240
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,775 Da
NCBI Official Full Name
Homo sapiens stromal antigen 3-like 1, mRNA
NCBI Official Synonym Full Names
stromal antigen 3-like 1 (pseudogene)
NCBI Official Symbol
STAG3L1
NCBI Official Synonym Symbols
STAG3L2; STAG3L3; STAG3L1P
UniProt Protein Name
Putative STAG3-like protein 1
Protein Family
UniProt Gene Name
STAG3L1
UniProt Entry Name
ST3L1_HUMAN
Uniprot Description
STAG3L1: Belongs to the SCC3 family.
Chromosomal Location of Human Ortholog: 7q11.23
Similar Products
Product Notes
The STAG3L1 stag3l1 (Catalog #AAA1268222) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtggaa gagagcaacg ccagagccca ggtgcccaga ggactttctt ccagcttctg ctgtccttct ttgtggagag caagctccac gaccacgctg cttacttagt agacaacctg tgggactgtg cagggactca gctgaaggac tgggagggtc tgacaagcct gctgctggag aaggaccaga gcacgtgcca catggagcca gggccaggga ccttccacct cctagggtga. It is sometimes possible for the material contained within the vial of "STAG3L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
