Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPNS3 cdna clone

SPNS3 cDNA Clone

Synonyms
SPNS3; SPNS3 cDNA Clone; SPNS3 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtttgcttcagactgtattcttggctcttcttcctgtcccggggcatcgtgggcactggctcggccagctactccaccatcgcgcccaccgtcctgggcgacctcttcgtgagggaccagcgcacccgcgtgctggctgtcttctacatctttatccccgttggaagtggtctgggctacgtgctggggtcggctgtgacgatgctgactgggaactggcgctgggccctccgagtcatgccctgcctggaggccgtggccttgatcctgcttatcctgctggttccagacccaccccggggagctgccgagacacagggggagggggccgtgggaggcttcagaagcagctggtgtgaggacgtcagatacctggggaaaaactggagttttgtgtggtcgaccctcggagtgaccgccatggcctttgtgactggagccctggggttctgggcccccaagtttctgctcgaggcacgcgtggttcacgggctgcagcctccctgcttccaggagccgtgcagcaaccccgacagcctgatttttggggcactgaccatcatgaccggcgtcattggggtcatcttgggggcagaagcttcgaggaggtacaagaaagtcattccaggagctgagcccctcatctgcgcctccagcctgcttgccacagccccctgcctctacctggctctcgtcctggccccgaccaccctgctggcctcctatgtgttcctgggccttggggagctgcttctgtcctgcaactgggcagtggttgccgacatcctgctgtctgtggtggtgcccagatgccgggggacggcagaggcacttcagatcacggtgggccacatcctgggagacgctggcagcccctatctcacaggacttatctctagtgtcctgcgggccaggcgccctgactcctatctgcagcgcttccgcagcctgcagcagagcttcctgtgctgcgcctttgtcatcgccctggggggcggctgcttcctgctgactgcgctgtacctggagagagacgagacccgggcctggcagcctgtcacagggaccccagacagcaatgatgtggacagcaacgacctggagagacaaggcctactttcgggcgctggcgcctctacagaggagccctga
Sequence Length
1158
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,339 Da
NCBI Official Full Name
Homo sapiens spinster homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
sphingolipid transporter 3 (putative)
NCBI Official Symbol
SPNS3
NCBI Protein Information
protein spinster homolog 3
UniProt Protein Name
Protein spinster homolog 3
Protein Family
UniProt Gene Name
SPNS3
UniProt Entry Name
SPNS3_HUMAN

Uniprot Description

SPNS3: Sphingolipid transporter. Belongs to the major facilitator (TC 2.A.1) superfamily. Spinster (TC 2.A.1.49) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p13.2

Cellular Component: lysosomal membrane; vesicle

Molecular Function: sphingolipid transporter activity

Biological Process: locomotion

Research Articles on SPNS3

Similar Products

Product Notes

The SPNS3 spns3 (Catalog #AAA1269598) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggttt gcttcagact gtattcttgg ctcttcttcc tgtcccgggg catcgtgggc actggctcgg ccagctactc caccatcgcg cccaccgtcc tgggcgacct cttcgtgagg gaccagcgca cccgcgtgct ggctgtcttc tacatcttta tccccgttgg aagtggtctg ggctacgtgc tggggtcggc tgtgacgatg ctgactggga actggcgctg ggccctccga gtcatgccct gcctggaggc cgtggccttg atcctgctta tcctgctggt tccagaccca ccccggggag ctgccgagac acagggggag ggggccgtgg gaggcttcag aagcagctgg tgtgaggacg tcagatacct ggggaaaaac tggagttttg tgtggtcgac cctcggagtg accgccatgg cctttgtgac tggagccctg gggttctggg cccccaagtt tctgctcgag gcacgcgtgg ttcacgggct gcagcctccc tgcttccagg agccgtgcag caaccccgac agcctgattt ttggggcact gaccatcatg accggcgtca ttggggtcat cttgggggca gaagcttcga ggaggtacaa gaaagtcatt ccaggagctg agcccctcat ctgcgcctcc agcctgcttg ccacagcccc ctgcctctac ctggctctcg tcctggcccc gaccaccctg ctggcctcct atgtgttcct gggccttggg gagctgcttc tgtcctgcaa ctgggcagtg gttgccgaca tcctgctgtc tgtggtggtg cccagatgcc gggggacggc agaggcactt cagatcacgg tgggccacat cctgggagac gctggcagcc cctatctcac aggacttatc tctagtgtcc tgcgggccag gcgccctgac tcctatctgc agcgcttccg cagcctgcag cagagcttcc tgtgctgcgc ctttgtcatc gccctggggg gcggctgctt cctgctgact gcgctgtacc tggagagaga cgagacccgg gcctggcagc ctgtcacagg gaccccagac agcaatgatg tggacagcaa cgacctggag agacaaggcc tactttcggg cgctggcgcc tctacagagg agccctga. It is sometimes possible for the material contained within the vial of "SPNS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.