Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNX3 cdna clone

SNX3 cDNA Clone

Gene Names
SNX3; SDP3; Grd19; MCOPS8
Synonyms
SNX3; SNX3 cDNA Clone; SNX3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagaccgtggctgacacccggcggctgatcaccaagccgcagaacctgaatgacgcctacggaccccccagcaacttcctcgagatcgatgtgagcaacccgcaaacggtgggggtcggccggggccgcttcaccacttacgaaatcagggtcaagacaaatcttcctattttcaagctgaaagaatctactgttagaagaagatacagtgactttgaatggctgcgaagtgaattagaaagagagagcaagccctgcctcagaatgacatcagaggcaaggagtcatggaaggacgtggtgtgctcagaatgatgaaaagttattttgtgactag
Sequence Length
342
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,316 Da
NCBI Official Full Name
Homo sapiens sorting nexin 3, mRNA
NCBI Official Synonym Full Names
sorting nexin 3
NCBI Official Symbol
SNX3
NCBI Official Synonym Symbols
SDP3; Grd19; MCOPS8
NCBI Protein Information
sorting nexin-3
UniProt Protein Name
Sorting nexin-3
Protein Family
UniProt Gene Name
SNX3
UniProt Entry Name
SNX3_HUMAN

NCBI Description

This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Uniprot Description

SNX3: Phosphoinositide-binding protein required for multivesicular body formation. Specifically binds phosphatidylinositol 3-phosphate (PtdIns(P3)). Plays a role in protein transport between cellular compartments. Promotes stability and cell surface expression of epithelial sodium channel (ENAC) subunits SCNN1A and SCNN1G. Not involved in EGFR degradation. A chromosomal aberration involving SNX3 may be a cause of microphthalmia syndromic type 8 (MCOPS8). Translocation t(6;13)(q21;q12). Microphthalmia is a clinically heterogeneous disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues (anophthalmia). In many cases, microphthalmia/anophthalmia occurs in association with syndromes that include non-ocular abnormalities. MCOPS8 is a very rare congenital syndrome characterized by microcephaly, microphthalmia, ectrodactyly of the lower limbs and prognathism. Intellectual deficit has been reported. Belongs to the sorting nexin family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: clathrin-coated vesicle; cytoplasm; cytosol; early endosome; early endosome membrane; endosome membrane; extrinsic to membrane; retromer complex

Molecular Function: phosphatidylinositol 3-phosphate binding; phosphatidylinositol-5-phosphate binding; protein binding; protein phosphatase binding

Biological Process: membrane invagination; negative regulation of phagocytosis; negative regulation of protein catabolic process; negative regulation of protein transport; negative regulation of virion penetration into host cell; protein to membrane docking; regulation of Wnt receptor signaling pathway; response to bacterium; Wnt receptor signaling pathway

Disease: Microphthalmia, Syndromic 8

Research Articles on SNX3

Similar Products

Product Notes

The SNX3 snx3 (Catalog #AAA1273777) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaga ccgtggctga cacccggcgg ctgatcacca agccgcagaa cctgaatgac gcctacggac cccccagcaa cttcctcgag atcgatgtga gcaacccgca aacggtgggg gtcggccggg gccgcttcac cacttacgaa atcagggtca agacaaatct tcctattttc aagctgaaag aatctactgt tagaagaaga tacagtgact ttgaatggct gcgaagtgaa ttagaaagag agagcaagcc ctgcctcaga atgacatcag aggcaaggag tcatggaagg acgtggtgtg ctcagaatga tgaaaagtta ttttgtgact ag. It is sometimes possible for the material contained within the vial of "SNX3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.