Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRPG cdna clone

SNRPG cDNA Clone

Gene Names
SNRPG; SMG; Sm-G
Synonyms
SNRPG; SNRPG cDNA Clone; SNRPG cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataa
Sequence Length
231
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,496 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein polypeptide G, mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein polypeptide G
NCBI Official Symbol
SNRPG
NCBI Official Synonym Symbols
SMG; Sm-G
NCBI Protein Information
small nuclear ribonucleoprotein G
UniProt Protein Name
Small nuclear ribonucleoprotein G
UniProt Gene Name
SNRPG
UniProt Synonym Gene Names
PBSCG; snRNP-G; Sm-G; SmG
UniProt Entry Name
RUXG_HUMAN

NCBI Description

The protein encoded by this gene is a component of the U1, U2, U4, and U5 small nuclear ribonucleoprotein complexes, precursors of the spliceosome. The encoded protein may also be a part of the U7 small nuclear ribonucleoprotein complex, which participates in the processing of the 3' end of histone transcripts. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Uniprot Description

snRNP G: Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing. Associated with snRNP U1, U2, U4/U6 and U5. Belongs to the snRNP Sm proteins family.

Protein type: Spliceosome; RNA splicing; RNA-binding

Chromosomal Location of Human Ortholog: 2p13.3

Cellular Component: cytosol; nucleoplasm; snRNP U1; snRNP U2; snRNP U5; spliceosome; U12-dependent spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: histone mRNA metabolic process; nuclear import; nuclear mRNA splicing, via spliceosome; RNA splicing; spliceosomal snRNP biogenesis; termination of RNA polymerase II transcription

Similar Products

Product Notes

The SNRPG snrpg (Catalog #AAA1269738) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaaag ctcaccctcc cgagttgaaa aaatttatgg acaagaagtt atcattgaaa ttaaatggtg gcagacatgt ccaaggaata ttgcggggat ttgatccctt tatgaacctt gtgatagatg aatgtgtgga gatggcgact agtggacaac agaacaatat tggaatggtg gtaatacgag gaaatagtat catcatgtta gaagccttgg aacgagtata a. It is sometimes possible for the material contained within the vial of "SNRPG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.