SNRNP40 cdna clone
SNRNP40 cDNA Clone
Gene Names
SNRNP40; 40K; SPF38; WDR57; PRP8BP; HPRP8BP; PRPF8BP
Synonyms
SNRNP40; SNRNP40 cDNA Clone; SNRNP40 cdna clone
Sequence
atgatagaacagcagaagcgtaagggcccagagttgccgctggttccagtcaagcggcagcggcatgagttgctgttgggagcggggtctggcccaggagccgggcagcagcaggcgacgccgggagccttgctgcaagcgggacctccaagatgttcctcccttcaagccccaatcatgctgctctctggacatgaaggggaagtctactgctgcaagttccaccccaacggatccaccttagcatctgcaggatttgaccgactgatattactgtggaatgtctatggtgactgtgataactatgccacactgaagggacacagtggagcagtgatggaattgcattacaacacagatggcagtatgcttttctcagcatccacagataaaaccgtggctgtgtgggatagtgaaacaggtgagagggttaaaaggctaaagggacatacttcctttgtgaattcctgttatccagccaggagaggccctcagcttgtctgcactggcagtgacgatggcacagttaagctttgggacatccggaagaaagcagccatccagacatttcagaacacgtaccaggtgttagctgtgaccttcaatgacacaagtgatcagattatttctggtggaatagacaatgatatcaaggtctgggacctgcgccagaacaagctaacctacaccatgagaggccatgcagattcagtgactggcctgagtttaagttctgaaggctcttatcttttgtccaatgcaatggacaatacagttcgtgtctgggatgtccggccatttgcccccaaagagagatgtgtaaagatatttcaaggaaatgtgcacaactttgaaaagaaccttctgagatgttcttggtcacctgatggaagcaaaatagcagctggctcagccgacaggtttgtttatgtgtgggataccacaagcaggagaatattgtataagctgcccggccatgctggctccatcaatgaagtggctttccaccctgatgagcccatcattatctcagcatcgagtgacaagagactgtatatgggagagattcagtga
Sequence Length
1074
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,516 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein 40kDa (U5), mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein U5 subunit 40
NCBI Official Symbol
SNRNP40
NCBI Official Synonym Symbols
40K; SPF38; WDR57; PRP8BP; HPRP8BP; PRPF8BP
NCBI Protein Information
U5 small nuclear ribonucleoprotein 40 kDa protein
UniProt Protein Name
U5 small nuclear ribonucleoprotein 40 kDa protein
Protein Family
UniProt Gene Name
SNRNP40
UniProt Synonym Gene Names
PRP8BP; SFP38; WDR57; U5 snRNP 40 kDa protein; U5-40K; hPRP8BP
UniProt Entry Name
SNR40_HUMAN
NCBI Description
This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Uniprot Description
WDR57: a nuclear WD40 repeat protein involved in pre-mRNA processing. A member of the spliceosome C complex. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, RNA processing and cytoskeleton assembly.
Protein type: Spliceosome; RNA splicing; RNA-binding
Chromosomal Location of Human Ortholog: 1p35.2
Cellular Component: cytoplasm; nucleoplasm; snRNP U5
Molecular Function: protein binding
Biological Process: nuclear mRNA splicing, via spliceosome; RNA processing; RNA splicing; RNA splicing, via transesterification reactions
Similar Products
Product Notes
The SNRNP40 snrnp40 (Catalog #AAA1266577) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatagaac agcagaagcg taagggccca gagttgccgc tggttccagt caagcggcag cggcatgagt tgctgttggg agcggggtct ggcccaggag ccgggcagca gcaggcgacg ccgggagcct tgctgcaagc gggacctcca agatgttcct cccttcaagc cccaatcatg ctgctctctg gacatgaagg ggaagtctac tgctgcaagt tccaccccaa cggatccacc ttagcatctg caggatttga ccgactgata ttactgtgga atgtctatgg tgactgtgat aactatgcca cactgaaggg acacagtgga gcagtgatgg aattgcatta caacacagat ggcagtatgc ttttctcagc atccacagat aaaaccgtgg ctgtgtggga tagtgaaaca ggtgagaggg ttaaaaggct aaagggacat acttcctttg tgaattcctg ttatccagcc aggagaggcc ctcagcttgt ctgcactggc agtgacgatg gcacagttaa gctttgggac atccggaaga aagcagccat ccagacattt cagaacacgt accaggtgtt agctgtgacc ttcaatgaca caagtgatca gattatttct ggtggaatag acaatgatat caaggtctgg gacctgcgcc agaacaagct aacctacacc atgagaggcc atgcagattc agtgactggc ctgagtttaa gttctgaagg ctcttatctt ttgtccaatg caatggacaa tacagttcgt gtctgggatg tccggccatt tgcccccaaa gagagatgtg taaagatatt tcaaggaaat gtgcacaact ttgaaaagaa ccttctgaga tgttcttggt cacctgatgg aagcaaaata gcagctggct cagccgacag gtttgtttat gtgtgggata ccacaagcag gagaatattg tataagctgc ccggccatgc tggctccatc aatgaagtgg ctttccaccc tgatgagccc atcattatct cagcatcgag tgacaagaga ctgtatatgg gagagattca gtga. It is sometimes possible for the material contained within the vial of "SNRNP40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
