Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRNP25 cdna clone

SNRNP25 cDNA Clone

Gene Names
SNRNP25; C16orf33
Synonyms
SNRNP25; SNRNP25 cDNA Clone; SNRNP25 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgtgttccaggagggtctggctatggtggtgcaggacccgctgctctgcgatctgccgatccaggttactctggaagaagtcaactcccaaatagccctagaatacggccaggcaatgacggtccgagtgtgcaagatggatggagaagtaatgcccgtggttgtagtgcagagtgccacagtcctggacctgaagaaggccatccagagatacgtgcagctcaagcaggagcgtgaagggggcattcagcacatcagctggtcctacgtgtggaggacgtaccatctgacctctgcaggagagaaactcacggaagacagaaagaagctccgagactacggcatccggaatcgagacgaggtttccttcatcaaaaagctgaggcaaaagtga
Sequence Length
399
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,270 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein 25kDa (U11/U12), mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein U11/U12 subunit 25
NCBI Official Symbol
SNRNP25
NCBI Official Synonym Symbols
C16orf33
NCBI Protein Information
U11/U12 small nuclear ribonucleoprotein 25 kDa protein
UniProt Protein Name
U11/U12 small nuclear ribonucleoprotein 25 kDa protein
UniProt Gene Name
SNRNP25
UniProt Synonym Gene Names
C16orf33; U11/U12 snRNP 25 kDa protein; U11/U12-25K
UniProt Entry Name
SNR25_HUMAN

NCBI Description

Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 25K protein that is a component of the U12-type spliceosome. [provided by RefSeq, Apr 2010]

Uniprot Description

SNRNP25: Component of the U11/U12 snRNPs that are part of the U12- type spliceosome.

Protein type: RNA processing; RNA splicing

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytoplasm; intercellular bridge; nucleoplasm; nucleus; U12-dependent spliceosome

Molecular Function: protein binding

Biological Process: nuclear mRNA splicing, via spliceosome; RNA splicing

Research Articles on SNRNP25

Similar Products

Product Notes

The SNRNP25 snrnp25 (Catalog #AAA1275776) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgtgt tccaggaggg tctggctatg gtggtgcagg acccgctgct ctgcgatctg ccgatccagg ttactctgga agaagtcaac tcccaaatag ccctagaata cggccaggca atgacggtcc gagtgtgcaa gatggatgga gaagtaatgc ccgtggttgt agtgcagagt gccacagtcc tggacctgaa gaaggccatc cagagatacg tgcagctcaa gcaggagcgt gaagggggca ttcagcacat cagctggtcc tacgtgtgga ggacgtacca tctgacctct gcaggagaga aactcacgga agacagaaag aagctccgag actacggcat ccggaatcga gacgaggttt ccttcatcaa aaagctgagg caaaagtga. It is sometimes possible for the material contained within the vial of "SNRNP25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.