Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMUG1 cdna clone

SMUG1 cDNA Clone

Gene Names
SMUG1; FDG; UNG3; HMUDG
Synonyms
SMUG1; SMUG1 cDNA Clone; SMUG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccccaggctttcctgctggggtccatccatgagcctgcaggtgccctcatggagccccagccctgccctggaagcttggctgagagcttcctggaggaggagcttcggctcaatgctgagctgagccagctgcagttttcggagcctgtgggcatcatctacaatcccgtggagtatgcatgggagccacatcgcaactacgtgactcgctactgccagggccccaaggaagtactcttcctgggcatgaaccctggaccttttggcatggcccagactggggtgccctttggggaagtaagcatggtccgggactggttgggcattgtggggcctgtgctgacccctccccaagagcatcctaaacgaccagtgctgggactggagtgcccacagtcagaaggaccaagacaaagcatgggacatgaaattaagagtgaacttcttatgggaggctgcagctggatcagaggaaaaatccagtgtgacagagtgcaagtcagaagacctggcttttcatcccagctttga
Sequence Length
534
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,627 Da
NCBI Official Full Name
Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1, mRNA
NCBI Official Synonym Full Names
single-strand-selective monofunctional uracil-DNA glycosylase 1
NCBI Official Symbol
SMUG1
NCBI Official Synonym Symbols
FDG; UNG3; HMUDG
NCBI Protein Information
single-strand selective monofunctional uracil DNA glycosylase
UniProt Protein Name
Single-strand selective monofunctional uracil DNA glycosylase
UniProt Gene Name
SMUG1
UniProt Entry Name
SMUG1_HUMAN

NCBI Description

This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011]

Uniprot Description

SMUG1: Responsible for recognizing base lesions in the genome and initiating base excision DNA repair. Acts as a monofunctional DNA glycosylase specific for uracil (U) residues in DNA and has a preference for single-stranded DNA substrates. The activity is greater against mismatches (U/G) than against matches (U/A). Excised uracil (U), 5-formyluracil (fU) and uracil derivatives bearing an oxidized group at C5 [5-hydroxyuracil (hoU) and 5- hydroxymethyluracil (hmU)] in ssDNA and dsDNA but not analogous cytosine derivatives (5-hydroxycytosine and 5-formylcytosine) and other oxidized damage. The activity is damage specificity and salt concentration-dependent. The general order of the preference for ssDNA and dsDNA is the following: ssDNA > dsDNA (G pair) = dsDNA (A pair) at the low salt concentration. At the high concentration dsDNA (G pair) > dsDNA (A pair) > ssDNA. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.2.2.-; DNA repair, damage; Hydrolase

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: nucleolus; nucleoplasm

Molecular Function: DNA N-glycosylase activity; oxidized pyrimidine base lesion DNA N-glycosylase activity; protein binding; single-strand selective uracil DNA N-glycosylase activity; uracil DNA N-glycosylase activity

Biological Process: base-excision repair; depyrimidination

Research Articles on SMUG1

Similar Products

Product Notes

The SMUG1 smug1 (Catalog #AAA1267393) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccagg ctttcctgct ggggtccatc catgagcctg caggtgccct catggagccc cagccctgcc ctggaagctt ggctgagagc ttcctggagg aggagcttcg gctcaatgct gagctgagcc agctgcagtt ttcggagcct gtgggcatca tctacaatcc cgtggagtat gcatgggagc cacatcgcaa ctacgtgact cgctactgcc agggccccaa ggaagtactc ttcctgggca tgaaccctgg accttttggc atggcccaga ctggggtgcc ctttggggaa gtaagcatgg tccgggactg gttgggcatt gtggggcctg tgctgacccc tccccaagag catcctaaac gaccagtgct gggactggag tgcccacagt cagaaggacc aagacaaagc atgggacatg aaattaagag tgaacttctt atgggaggct gcagctggat cagaggaaaa atccagtgtg acagagtgca agtcagaaga cctggctttt catcccagct ttga. It is sometimes possible for the material contained within the vial of "SMUG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.