Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCC2 cdna clone

SMARCC2 cDNA Clone

Gene Names
SMARCC2; Rsc8; BAF170; CRACC2
Synonyms
SMARCC2; SMARCC2 cDNA Clone; SMARCC2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgcggaagaaggacggcggccccaacgtgaagtactacgaggccgcggacaccgtgacccagttcgacaacgtgcggctgtggctcggcaagaactacaagaagtatatacaagctgaaccacccaccaacaagtccctgtctagcctggttgtacagttgctacaatttcaggaagaagtttttggcaaacatgtcagcaatgcaccgctcactaaactgccgatcaaatgtttcctagatttcaaagcgggaggctccttgtgccacattcttgcagctgcctacaaattcaagagtgaccagggatggcggcgttacgatttccagaatccatcacgcatggaccgcaatgtggaaatgtttatgaccattgagaagtccttggtgcagaataattgcctgtctcgacctaacatttttctgtgcccagaaattgagcccaaactactagggaaattaaaggacattatcaagagacaccagggaacagtcactgaggataagaacaatgcctcccatgttgtgtatcctgtcccggggaatctagaagaagaggaatgggtacgaccagtcatgaagagggataagcaggttcttctgcactggggctactatcctgacagttacgacacgtggatcccagcgagtgaaattgaggcatctgtggaagatgctccaactcctgagaaacctaggaaggttcatgcaaagtggatcctggacaccgacaccttcaatgaatggatgaatgaggaagactatgaagtaaatgatgacaaaaaccctgtctcccgccgaaagaagatttcagccaagacactgacagatgaggtgaacagcccagattcagatcgacgggacaagaaggggggaaactataagaagaggaagcgctccccctctccttcaccaaccccagaagcaaagaagaaaaatgctaagaaaggtccctcaacaccttacactaagtcaaagcgtggccacagagaagaggagcaagaagacctgacaaaggacatggacgagccctcaccagtccccaatgtagaagaggtgacacttcccaaaacagtcaacacaaagaaagactcagagtcggccccagtcaaaggcggcaccatgaccgacctggatgaacaggaagatgaaagcatggagacgacgggcaaggatgaggatgagaacagtacggggaacaagggagagcagaccaagaatccagacctgcatgaggacaatgtgactgaacagacccaccacatcatcattcccagctacgctgcctggtttgactacaatagtgttcatgccattgagcggagggctctccccgagttcttcaacggcaagaacaagtccaagactccagagatctacctggcctatcgaaactttatgattgacacttaccgactgaacccccaagagtatcttacctctaccgcctgccgccgaaacctagcgggtgatgtctgtgccatcatgagggtccatgccttcctagaacagtggggtcttattaactaccaggtggatgctgagagtcgaccaaccccaatggggcctccgcctacctctcacttccatgtcttggctgacacaccatcagggctggtgcctctgcagcccaagacacctcagggccgccaggttgatgctgataccaaggctgggcgaaagggcaaagagctggatgacctggtgccagagacggctaagggcaagccagagctgcagacctctgcttcccaacaaatgctcaactttcctgacaaaggcaaagagaaaccaacagacatgcaaaactttgggctgcgcacagacatgtacacaaaaaagaatgttccctccaagagcaaggctgcagccagtgccactcgtgagtggacagaacaggaaaccctgcttctcctggaggcactggaaatgtacaaagatgactggaacaaagtgtccgagcatgtgggaagccgcacacaggacgagtgcatcttgcattttcttcgtcttcccattgaagacccatacctggaggactcagaggcctccctaggccccctggcctaccaacccatccccttcagtcagtcgggcaaccctgttatgagcactgttgccttcctggcctctgtcgtcgatccccgagtcgcctctgctgctgcaaagtcagccctagaggagttctccaaaatgaaggaagaggtacccacggccttggtggaggcccatgttcgaaaagtggaagaagcagccaaagtaacaggcaaggcggaccctgccttcggtctggaaagcagtggcattgcaggaaccacctctgatgagcctgagcggattgaggagagcgggaatgacgaggctcgggtggaaggccaggccacagatgagaagaaggagcccaaggaaccccgagaaggagggggtgctatagaggaggaagcaaaagagaaaaccagcgaggctcccaagaaggatgaggagaaagggaaagaaggcgacagtgagaaggagtccgagaagagtgatggagacccaatagtcgatcctgagaaggagaaggagccaaaggaagggcaggaggaagtgctgaaggaagtggtggagtctgagggggaaaggaagacaaaggtggagcgggacattggcgagggcaacctctccaccgctgctgccgccgccctggccgccgccgcagtgaaagctaagcactttgctgctgttgaggaaaggaagatcaaatctttggtggccctgctggtggagacccagatgaaaaagttggagatcaaacttcggcactttgaggagctggagactatcatggaccgggagcgagaagcactggagtatcagaggcagcagctcctggccgacagacaagccttccacatggagcagctgaagtatgcggagatgagggctcggcagcagcacttccaacagatgcaccaacagcagcagcagccaccaccagccctgcccccaggctcccagcctatccccccaacaggggctgctgggccacccgcagtccatggcttggctgtggctccagcctctgtagtccctgctcctgctggcagtggggcccctccaggaagtttgggcccttctgaacagattgggcaggcagggtcaactgcagggccacagcagcagcaaccagctggagccccccagcctggggcagtcccaccaggggttcccccccctggaccccatggcccctcaccgttccccaaccaacaaactcctccctcaatgatgccaggggcagtgccaggcagcgggcacccaggcgtggcggacccaggcacccccctgcctccagaccccacagccccgagcccaggcacggtcacccctgtgccacctccacagtga
Sequence Length
3393
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
126,924 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2
NCBI Official Symbol
SMARCC2
NCBI Official Synonym Symbols
Rsc8; BAF170; CRACC2
NCBI Protein Information
SWI/SNF complex subunit SMARCC2
UniProt Protein Name
SWI/SNF complex subunit SMARCC2
Protein Family
UniProt Gene Name
SMARCC2
UniProt Synonym Gene Names
BAF170; BAF170
UniProt Entry Name
SMRC2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SMARCC2: a core component of the BAF (SWI/SNF) complex. This family of complexes remodels chromatin structures, enabling transcription factors to gain access to DNA. They play important roles in cell proliferation and differentiation, in cellular antiviral activities and inhibition of tumor formation. The BAF complex is able to create a stable, altered form of chromatin that constrains fewer negative supercoils than normal. This change in supercoiling is due to the conversion of up to one-half of the nucleosomes on polynucleosomal arrays into asymmetric structures, termed altosomes, each composed of 2 histones octamers. May be required for CoREST dependent repression of neuronal specific gene promoters in non-neuronal cells. Belongs to the neural progenitors- specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain BAF53A and PHF10, are exchanged for homologous alternative BAF53B and BAF45B or BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Also involved in vitamin D-coupled transcription regulation via its association with the WINAC complex, a chromatin-remodeling complex recruited by vitamin D receptor (VDR), which is required for the ligand- bound VDR-mediated transrepression of the CYP27B1 gene. Component of 6 multiprotein chromatin-remodeling complexes: Swi/Snf-A (BAF), Swi/Snf-B (PBAF), Brm, Brg1(I), WINAC and Brg1(II). Each of the five complexes contains a catalytic subunit (either SMARCA4 or SMARCA2), and at least SMARCE1, BAF53A or BAF53B, SMARCC2 and SMARCB1. Other subunits specific to each of the complexes may also be present. Component of the BAF (hSWI/SNF) complex, which includes at least actin (ACTB), ARID1A, ARID1B, SMARCA2, SMARCA4, BAF53A, BAF53B, SMARCE1 SMARCC1, SMARCC2, SMARCB1, and one or more of SMARCD1, SMARCD2, or SMARCD3. In muscle cells, the BAF complex also contains DPF3. May also interact with the SIN3A histone deacetylase transcription repressor complex in conjunction with SMARCA2 and SMARCA4. The minimal complex composed of SMARCC1 and SMARCA4 seems to be able to associate with cyclin such as CCNE1 or transcription factors such as KLF1 or GATA1. Ubiquitously expressed. Belongs to the SMARCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; DNA-binding

Chromosomal Location of Human Ortholog: 12q13.2

Cellular Component: nuclear chromatin; nucleoplasm; protein complex; SWI/SNF complex; transcriptional repressor complex

Molecular Function: nucleosomal DNA binding; protein binding

Biological Process: ATP-dependent chromatin remodeling; chromatin remodeling; negative regulation of transcription, DNA-dependent; nucleosome disassembly; positive regulation of transcription, DNA-dependent

Research Articles on SMARCC2

Similar Products

Product Notes

The SMARCC2 smarcc2 (Catalog #AAA1276638) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgc ggaagaagga cggcggcccc aacgtgaagt actacgaggc cgcggacacc gtgacccagt tcgacaacgt gcggctgtgg ctcggcaaga actacaagaa gtatatacaa gctgaaccac ccaccaacaa gtccctgtct agcctggttg tacagttgct acaatttcag gaagaagttt ttggcaaaca tgtcagcaat gcaccgctca ctaaactgcc gatcaaatgt ttcctagatt tcaaagcggg aggctccttg tgccacattc ttgcagctgc ctacaaattc aagagtgacc agggatggcg gcgttacgat ttccagaatc catcacgcat ggaccgcaat gtggaaatgt ttatgaccat tgagaagtcc ttggtgcaga ataattgcct gtctcgacct aacatttttc tgtgcccaga aattgagccc aaactactag ggaaattaaa ggacattatc aagagacacc agggaacagt cactgaggat aagaacaatg cctcccatgt tgtgtatcct gtcccgggga atctagaaga agaggaatgg gtacgaccag tcatgaagag ggataagcag gttcttctgc actggggcta ctatcctgac agttacgaca cgtggatccc agcgagtgaa attgaggcat ctgtggaaga tgctccaact cctgagaaac ctaggaaggt tcatgcaaag tggatcctgg acaccgacac cttcaatgaa tggatgaatg aggaagacta tgaagtaaat gatgacaaaa accctgtctc ccgccgaaag aagatttcag ccaagacact gacagatgag gtgaacagcc cagattcaga tcgacgggac aagaaggggg gaaactataa gaagaggaag cgctccccct ctccttcacc aaccccagaa gcaaagaaga aaaatgctaa gaaaggtccc tcaacacctt acactaagtc aaagcgtggc cacagagaag aggagcaaga agacctgaca aaggacatgg acgagccctc accagtcccc aatgtagaag aggtgacact tcccaaaaca gtcaacacaa agaaagactc agagtcggcc ccagtcaaag gcggcaccat gaccgacctg gatgaacagg aagatgaaag catggagacg acgggcaagg atgaggatga gaacagtacg gggaacaagg gagagcagac caagaatcca gacctgcatg aggacaatgt gactgaacag acccaccaca tcatcattcc cagctacgct gcctggtttg actacaatag tgttcatgcc attgagcgga gggctctccc cgagttcttc aacggcaaga acaagtccaa gactccagag atctacctgg cctatcgaaa ctttatgatt gacacttacc gactgaaccc ccaagagtat cttacctcta ccgcctgccg ccgaaaccta gcgggtgatg tctgtgccat catgagggtc catgccttcc tagaacagtg gggtcttatt aactaccagg tggatgctga gagtcgacca accccaatgg ggcctccgcc tacctctcac ttccatgtct tggctgacac accatcaggg ctggtgcctc tgcagcccaa gacacctcag ggccgccagg ttgatgctga taccaaggct gggcgaaagg gcaaagagct ggatgacctg gtgccagaga cggctaaggg caagccagag ctgcagacct ctgcttccca acaaatgctc aactttcctg acaaaggcaa agagaaacca acagacatgc aaaactttgg gctgcgcaca gacatgtaca caaaaaagaa tgttccctcc aagagcaagg ctgcagccag tgccactcgt gagtggacag aacaggaaac cctgcttctc ctggaggcac tggaaatgta caaagatgac tggaacaaag tgtccgagca tgtgggaagc cgcacacagg acgagtgcat cttgcatttt cttcgtcttc ccattgaaga cccatacctg gaggactcag aggcctccct aggccccctg gcctaccaac ccatcccctt cagtcagtcg ggcaaccctg ttatgagcac tgttgccttc ctggcctctg tcgtcgatcc ccgagtcgcc tctgctgctg caaagtcagc cctagaggag ttctccaaaa tgaaggaaga ggtacccacg gccttggtgg aggcccatgt tcgaaaagtg gaagaagcag ccaaagtaac aggcaaggcg gaccctgcct tcggtctgga aagcagtggc attgcaggaa ccacctctga tgagcctgag cggattgagg agagcgggaa tgacgaggct cgggtggaag gccaggccac agatgagaag aaggagccca aggaaccccg agaaggaggg ggtgctatag aggaggaagc aaaagagaaa accagcgagg ctcccaagaa ggatgaggag aaagggaaag aaggcgacag tgagaaggag tccgagaaga gtgatggaga cccaatagtc gatcctgaga aggagaagga gccaaaggaa gggcaggagg aagtgctgaa ggaagtggtg gagtctgagg gggaaaggaa gacaaaggtg gagcgggaca ttggcgaggg caacctctcc accgctgctg ccgccgccct ggccgccgcc gcagtgaaag ctaagcactt tgctgctgtt gaggaaagga agatcaaatc tttggtggcc ctgctggtgg agacccagat gaaaaagttg gagatcaaac ttcggcactt tgaggagctg gagactatca tggaccggga gcgagaagca ctggagtatc agaggcagca gctcctggcc gacagacaag ccttccacat ggagcagctg aagtatgcgg agatgagggc tcggcagcag cacttccaac agatgcacca acagcagcag cagccaccac cagccctgcc cccaggctcc cagcctatcc ccccaacagg ggctgctggg ccacccgcag tccatggctt ggctgtggct ccagcctctg tagtccctgc tcctgctggc agtggggccc ctccaggaag tttgggccct tctgaacaga ttgggcaggc agggtcaact gcagggccac agcagcagca accagctgga gccccccagc ctggggcagt cccaccaggg gttccccccc ctggacccca tggcccctca ccgttcccca accaacaaac tcctccctca atgatgccag gggcagtgcc aggcagcggg cacccaggcg tggcggaccc aggcaccccc ctgcctccag accccacagc cccgagccca ggcacggtca cccctgtgcc acctccacag tga. It is sometimes possible for the material contained within the vial of "SMARCC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.