Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCB1 cdna clone

SMARCB1 cDNA Clone

Gene Names
SMARCB1; RDT; CSS3; INI1; SNF5; Snr1; BAF47; MRD15; RTPS1; Sfh1p; hSNFS; SNF5L1; SWNTS1; PPP1R144
Synonyms
SMARCB1; SMARCB1 cDNA Clone; SMARCB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgatgatggcgctgagcaagaccttcgggcagaagcccgtgaagttccagctggaggacgacggcgagttctacatgatcggctccgaggtgggaaactacctccgtatgttccgaggttctctgtacaagagatacccctcactctggaggcgactagccactgtggaagagaggaagaaaatagttgcatcgtcacatgatcacggatacacgactctagccaccagtgtgaccctgttaaaagcctcggaagtggaagagattctggatggcaacgatgagaagtacaaggctgtgtccatcagcacagagccccccacctacctcagggaacagaaggccaagaggaacagccagtgggtacccaccctgcccaacagctcccaccacttagatgccgtgccatgctccacaaccatcaacaggaaccgcatgggccgagacaagaagagaaccttccccctttgctttgatgaccatgacccagctgtgatccatgagaacgcatctcagcccgaggtgctggtccccatccggctggacatggagatcgatgggcagaagctgcgagacgccttcacctggaacatgaatgagaagttgatgacgcctgagatgttttcagaaatcctctgtgacgatctggatttgaacccgctgacgtttgtgccagccatcgcctctgccatcagacagcagatcgagtcctaccccacggacagcatcctggaggaccagtcagaccagcgcgtcatcatcaagctgaacatccatgtgggaaacatttccctggtggaccagtttgagtgggacatgtcagagaaggagaactcaccagagaagtttgccctgaagctgtgctcggagctggggttgggcggggagtttgtcaccaccatcgcatacagcatccggggacagctgagctggcatcagaagacctacgccttcagcgagaaccctctgcccacagtggagattgccatccggaacacgggcgatgcggaccagtggtgcccactgctggagactctgacagacgctgagatggagaagaagatccgcgaccaggacaggaacacgaggcggatgaggcgtcttgccaacacggccccggcctggtaa
Sequence Length
1131
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,158 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
NCBI Official Symbol
SMARCB1
NCBI Official Synonym Symbols
RDT; CSS3; INI1; SNF5; Snr1; BAF47; MRD15; RTPS1; Sfh1p; hSNFS; SNF5L1; SWNTS1; PPP1R144
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1
UniProt Gene Name
SMARCB1
UniProt Synonym Gene Names
BAF47; INI1; SNF5L1; BAF47; hSNF5
UniProt Entry Name
SNF5_HUMAN

NCBI Description

The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]

Uniprot Description

SMARCB1: a core component of the BAF (hSWI/SNF) complex. This family of complexes remodels chromatin structures, enabling transcription factors to gain access to DNA. They play important roles in cell proliferation and differentiation, in cellular antiviral activities and inhibition of tumor formation. The BAF complex is able to create a stable, altered form of chromatin that constrains fewer negative supercoils than normal. This change in supercoiling is due to the conversion of up to one-half of the nucleosomes on polynucleosomal arrays into asymmetric structures, termed altosomes, each composed of 2 histones octamers. Stimulates in vitro the remodeling activity of SMARCA4. Involved in activation of CSF1 promoter. Belongs to the neural progenitors- specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain BAF53A and PHF10, are exchanged for homologous alternative BAF53B and BAF45B or BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Plays a key role in cell-cycle control and causes cell cycle arrest in G0/G1. Also involved in vitamin D-coupled transcription regulation via its association with the WINAC complex, a chromatin-remodeling complex recruited by vitamin D receptor (VDR), which is required for the ligand- bound VDR-mediated transrepression of the CYP27B1 gene. Component of the BAF (hSWI/SNF) complex, which includes at least actin (ACTB), ARID1A, ARID1B, SMARCA2, SMARCA4, BAF53A, BAF53B, SMARCE1 SMARCC1, SMARCC2, SMARCB1, and one or more of SMARCD1, SMARCD2, or SMARCD3. In muscle cells, the BAF complex also contains DPF3. Component of the WINAC complex, at least composed of SMARCA2, SMARCA4, SMARCB1, SMARCC1, SMARCC2, SMARCD1, SMARCE1, ACTL6A, WSTF, ARID1A, SUPT16H, CHAF1A and TOP2B. Binds to double-stranded DNA. Interacts with EphB4 and MAEL. Interacts with GADD34. Binds tightly to the human immunodeficiency virus-type 1 (HIV-1) integrase in vitro and stimulates its DNA-joining activity. Interacts with human papillomavirus 18 E1 protein to stimulates its viral replication. Belongs to the SNF5 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; Transcription, coactivator/corepressor; Cell cycle regulation

Chromosomal Location of Human Ortholog: 22q11.23|22q11

Cellular Component: nuclear chromatin; nucleolus; nucleoplasm; nucleus; protein complex; SWI/SNF complex

Molecular Function: DNA binding; nucleosomal DNA binding; p53 binding; protein binding; Tat protein binding; transcription coactivator activity

Biological Process: ATP-dependent chromatin remodeling; cell differentiation; chromatin remodeling; DNA integration; DNA repair; negative regulation of cell proliferation; nucleosome disassembly; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter

Disease: Mental Retardation, Autosomal Dominant 15; Rhabdoid Tumor Predisposition Syndrome 1; Schwannomatosis 1

Research Articles on SMARCB1

Similar Products

Product Notes

The SMARCB1 smarcb1 (Catalog #AAA1272147) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgatga tggcgctgag caagaccttc gggcagaagc ccgtgaagtt ccagctggag gacgacggcg agttctacat gatcggctcc gaggtgggaa actacctccg tatgttccga ggttctctgt acaagagata cccctcactc tggaggcgac tagccactgt ggaagagagg aagaaaatag ttgcatcgtc acatgatcac ggatacacga ctctagccac cagtgtgacc ctgttaaaag cctcggaagt ggaagagatt ctggatggca acgatgagaa gtacaaggct gtgtccatca gcacagagcc ccccacctac ctcagggaac agaaggccaa gaggaacagc cagtgggtac ccaccctgcc caacagctcc caccacttag atgccgtgcc atgctccaca accatcaaca ggaaccgcat gggccgagac aagaagagaa ccttccccct ttgctttgat gaccatgacc cagctgtgat ccatgagaac gcatctcagc ccgaggtgct ggtccccatc cggctggaca tggagatcga tgggcagaag ctgcgagacg ccttcacctg gaacatgaat gagaagttga tgacgcctga gatgttttca gaaatcctct gtgacgatct ggatttgaac ccgctgacgt ttgtgccagc catcgcctct gccatcagac agcagatcga gtcctacccc acggacagca tcctggagga ccagtcagac cagcgcgtca tcatcaagct gaacatccat gtgggaaaca tttccctggt ggaccagttt gagtgggaca tgtcagagaa ggagaactca ccagagaagt ttgccctgaa gctgtgctcg gagctggggt tgggcgggga gtttgtcacc accatcgcat acagcatccg gggacagctg agctggcatc agaagaccta cgccttcagc gagaaccctc tgcccacagt ggagattgcc atccggaaca cgggcgatgc ggaccagtgg tgcccactgc tggagactct gacagacgct gagatggaga agaagatccg cgaccaggac aggaacacga ggcggatgag gcgtcttgcc aacacggccc cggcctggta a. It is sometimes possible for the material contained within the vial of "SMARCB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.