Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35E3 cdna clone

SLC35E3 cDNA Clone

Gene Names
SLC35E3; BLOV1
Synonyms
SLC35E3; SLC35E3 cDNA Clone; SLC35E3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcattgctggtggaccgagtgcggggccactggcgaatcgccgccgggctcctgttcaacctgctggtgtccatctgcattgtgttcctcaacaaatggatttatgtgtaccacggcttccccaacatgagcctgaccctggtgcacttcgtggtcacctggctgggcttgtatatctgccagaagctggacatctttgcccccaaaagtctgccgccctccaggctcctcctcctggccctcagcttctgtggctttgtggtcttcactaacctttctctgcagaacaacaccataggcacctatcagctggccaaggccatgaccacgccggtgatcatagccatccagaccttctgctaccagaaaaccttctccaccagaatccagctcacgctgattcctataactttaggtgtaatcctaaattcttattacgatgtgaagtttaatttccttggaatggtgtttgctgctcttggtgttttagttacatccctttatcaagtgtgggtaggagccaaacagcatgaattacaagtgaactcaatgcagctgctgtactaccaggctccgatgtcatctgccatgttgctggttgctgtgcccttctttgagccagtgtttggagaaggaggaatatttggtccctggtcagtttctgctttgcttatggtgctgctatctggagtaatagctttcatggtgaacttatcaatttattggatcattgggaacacttcacctgtcacctataacatgttcggacacttcaagttctgcattactttattcggaggatatgttttatttaaggatccactgtccattaatcaggcccttggcattttatgtacattatttggcattctcgcctatacccactttaagctcagtgaacaggaaggaagtaggagtaaactggcacaacgtccttaa
Sequence Length
942
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,066 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35, member E3, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member E3
NCBI Official Symbol
SLC35E3
NCBI Official Synonym Symbols
BLOV1
NCBI Protein Information
solute carrier family 35 member E3
UniProt Protein Name
Solute carrier family 35 member E3
Protein Family
UniProt Gene Name
SLC35E3
UniProt Synonym Gene Names
BLOV1
UniProt Entry Name
S35E3_HUMAN

Uniprot Description

SLC35E3: Putative transporter. Belongs to the TPT transporter family. SLC35E subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 12q15

Molecular Function: nucleotide-sugar transmembrane transporter activity

Similar Products

Product Notes

The SLC35E3 slc35e3 (Catalog #AAA1270925) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcattgc tggtggaccg agtgcggggc cactggcgaa tcgccgccgg gctcctgttc aacctgctgg tgtccatctg cattgtgttc ctcaacaaat ggatttatgt gtaccacggc ttccccaaca tgagcctgac cctggtgcac ttcgtggtca cctggctggg cttgtatatc tgccagaagc tggacatctt tgcccccaaa agtctgccgc cctccaggct cctcctcctg gccctcagct tctgtggctt tgtggtcttc actaaccttt ctctgcagaa caacaccata ggcacctatc agctggccaa ggccatgacc acgccggtga tcatagccat ccagaccttc tgctaccaga aaaccttctc caccagaatc cagctcacgc tgattcctat aactttaggt gtaatcctaa attcttatta cgatgtgaag tttaatttcc ttggaatggt gtttgctgct cttggtgttt tagttacatc cctttatcaa gtgtgggtag gagccaaaca gcatgaatta caagtgaact caatgcagct gctgtactac caggctccga tgtcatctgc catgttgctg gttgctgtgc ccttctttga gccagtgttt ggagaaggag gaatatttgg tccctggtca gtttctgctt tgcttatggt gctgctatct ggagtaatag ctttcatggt gaacttatca atttattgga tcattgggaa cacttcacct gtcacctata acatgttcgg acacttcaag ttctgcatta ctttattcgg aggatatgtt ttatttaagg atccactgtc cattaatcag gcccttggca ttttatgtac attatttggc attctcgcct atacccactt taagctcagt gaacaggaag gaagtaggag taaactggca caacgtcctt aa. It is sometimes possible for the material contained within the vial of "SLC35E3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.