Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35A1 cdna clone

SLC35A1 cDNA Clone

Gene Names
SLC35A1; CST; hCST; CDG2F; CMPST
Synonyms
SLC35A1; SLC35A1 cDNA Clone; SLC35A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgccccgagagacaatgtcactttattattcaagttatactgcttggcagtgatgaccctgatggctgcagtctataccatagctttaagatacacaaggacatcagacaaagaactctacttttcaaccacagccgtgtgtatcacagaagttataaagttattgctaagtgtgggaattttagctaaagaaactggtagtctgggtagattcaaagcatctttaagagaaaatgtcttggggagccccaaggaactgttgaagttaagtgtgccatcgttagtgtatgctgttcagaacaacatggctttcctagctcttagcaatctggatgcagcagtgtaccaggtgacctaccagttgaagattccgtgtactgctttatgcactgttttaatgttaaaccggacactcagcaaattacagtgggtttcagtttttatgctgtgtgctggagttacgcttgtacagtggaaaccagcccaagctacaaaagtggtggtggaacaaaatccattattagggtttggcgctatagctattgctgtattgtgctcaggatttgcaggagtatattttgaaaaagttttaaagagttcagatacttctctttgggtgagaaacattcaaatgtatctatcagggattattgtgacattagctggcgtctacttgtcagatggagctgaaattaaagaaaaaggatttttctatggttacacatattatgtctggtttgtcatctttcttgcaagtgttggtggcctctacacttctgttgtggttaagtacacagacaacatcatgaaaggcttttctgcagcagcggccattgtcctttccaccattgcttcagtaatgctgtttggattacagataacactcacctttgccctgggtactcttcttgtatgtgtttccatatatctctatggattacccagacaagacactacatccatccaacaaggagaaacagcttcaaaggagagagttattggtgtgtga
Sequence Length
1014
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,919 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35 (CMP-sialic acid transporter), member A1, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member A1
NCBI Official Symbol
SLC35A1
NCBI Official Synonym Symbols
CST; hCST; CDG2F; CMPST
NCBI Protein Information
CMP-sialic acid transporter
UniProt Protein Name
CMP-sialic acid transporter
UniProt Gene Name
SLC35A1
UniProt Synonym Gene Names
CMP-SA-Tr; CMP-Sia-Tr
UniProt Entry Name
S35A1_HUMAN

NCBI Description

The protein encoded by this gene is found in the membrane of the Golgi apparatus, where it transports nucleotide sugars into the Golgi. One such nucleotide sugar is CMP-sialic acid, which is imported into the Golgi by the encoded protein and subsequently glycosylated. Defects in this gene are a cause of congenital disorder of glycosylation type 2F (CDG2F). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]

Uniprot Description

SLC35A1: Transports CMP-sialic acid from the cytosol into Golgi vesicles where glycosyltransferases function. Defects in SLC35A1 are the cause of congenital disorder of glycosylation type 2F (CDG2F). CDGs are a family of severe inherited diseases caused by a defect in protein N- glycosylation. They are characterized by under-glycosylated serum proteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the nucleotide-sugar transporter family. SLC35A subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass; Transporter

Chromosomal Location of Human Ortholog: 6q15

Cellular Component: Golgi apparatus; Golgi membrane; integral to plasma membrane

Molecular Function: CMP-sialic acid transmembrane transporter activity

Biological Process: carbohydrate metabolic process; CMP-sialic acid transport; protein modification process

Disease: Congenital Disorder Of Glycosylation, Type Iif

Research Articles on SLC35A1

Similar Products

Product Notes

The SLC35A1 slc35a1 (Catalog #AAA1266725) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgccc cgagagacaa tgtcacttta ttattcaagt tatactgctt ggcagtgatg accctgatgg ctgcagtcta taccatagct ttaagataca caaggacatc agacaaagaa ctctactttt caaccacagc cgtgtgtatc acagaagtta taaagttatt gctaagtgtg ggaattttag ctaaagaaac tggtagtctg ggtagattca aagcatcttt aagagaaaat gtcttgggga gccccaagga actgttgaag ttaagtgtgc catcgttagt gtatgctgtt cagaacaaca tggctttcct agctcttagc aatctggatg cagcagtgta ccaggtgacc taccagttga agattccgtg tactgcttta tgcactgttt taatgttaaa ccggacactc agcaaattac agtgggtttc agtttttatg ctgtgtgctg gagttacgct tgtacagtgg aaaccagccc aagctacaaa agtggtggtg gaacaaaatc cattattagg gtttggcgct atagctattg ctgtattgtg ctcaggattt gcaggagtat attttgaaaa agttttaaag agttcagata cttctctttg ggtgagaaac attcaaatgt atctatcagg gattattgtg acattagctg gcgtctactt gtcagatgga gctgaaatta aagaaaaagg atttttctat ggttacacat attatgtctg gtttgtcatc tttcttgcaa gtgttggtgg cctctacact tctgttgtgg ttaagtacac agacaacatc atgaaaggct tttctgcagc agcggccatt gtcctttcca ccattgcttc agtaatgctg tttggattac agataacact cacctttgcc ctgggtactc ttcttgtatg tgtttccata tatctctatg gattacccag acaagacact acatccatcc aacaaggaga aacagcttca aaggagagag ttattggtgt gtga. It is sometimes possible for the material contained within the vial of "SLC35A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.