SLC2A3 cdna clone
SLC2A3 cDNA Clone
Gene Names
SLC2A3; GLUT3
Synonyms
SLC2A3; SLC2A3 cDNA Clone; SLC2A3 cdna clone
Sequence
atggggacacagaaggtcaccccagctctgatatttgccatcacagttgctacaatcggctctttccaatttggctacaacactggggtcatcaatgctcctgagaagatcataaaggaatttatcaataaaactttgacggacaagggaaatgccccaccctctgaggtgctgctcacgtctctctggtccttgtctgtggccatattttccgtcgggggtatgatcggctccttttccgtcggactcttcgtcaaccgctttggcaggcgcaattcaatgctgattgtcaacctgttggctgtcactggtggctgctttatgggactgtgtaaagtagctaagtcggttgaaatgctgatcctgggtcgcttggttattggcctcttctgcggactctgcacaggttttgtgcccatgtacattggagagatctcgcctactgccctgcggggtgcctttggcactctcaaccagctgggcatcgttgttggaattctggtggcccagatctttggtctggaattcatccttgggtctgaagagctatggccgctgctactgggttttaccatccttcctgctatcctacaaagtgcagcccttccattttgccctgaaagtcccagatttttgctcattaacagaaaagaagaggagaatgctaagcagatcctccagcggttgtggggcacccaggatgtatcccaagacatccaggagatgaaagatgagagtgcaaggatgtcacaagaaaagcaagtcaccgtgctagagctctttagagtgtccagctaccgacagcccatcatcatttccattgtgctccagctctctcagcagctctctgggatcaatgctgtgttctattactcaacaggaatcttcaaggatgcaggtgttcaagagcccatctatgccaccatcggcgcgggtgtggttaatactatcttcactgtagtttctctatttctggtggaaagggcaggaagaaggactctgcatatgataggccttggagggatggctttttgttccacgctcatgactgtttctttgttattaaaggataactataatgggatgagctttgtctgtattggggctatcttggtctttgtagccttctttgaaattggaccaggccccattccctggtttattgtggccgaactcttcagccagggcccccgcccagctgcgatggcagtggccggctgctccaactggacctccaacttcctagtcggattgctcttcccctccgctgctcactatttaggagcctacgtttttattatcttcaccggcttcctcattaccttcttggcttttaccttcttcaaagtccctgagacccgtggcaggacttttgaggatatcacacgggcctttgaagggcaggcacacggtgcagatagatctggaaaggacggcgtcatggagatgaacagcatcgagcctgctaaggagaccaccaccaatgtctaa
Sequence Length
1491
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,924 Da
NCBI Official Full Name
Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 3, mRNA
NCBI Official Synonym Full Names
solute carrier family 2 member 3
NCBI Official Symbol
SLC2A3
NCBI Official Synonym Symbols
GLUT3
NCBI Protein Information
solute carrier family 2, facilitated glucose transporter member 3
UniProt Protein Name
Solute carrier family 2, facilitated glucose transporter member 3
Protein Family
UniProt Gene Name
SLC2A3
UniProt Synonym Gene Names
GLUT3; GLUT-3
UniProt Entry Name
GTR3_HUMAN
Uniprot Description
GLUT3: an integral membrane facilitative glucose transporter. One of 13 members of the human equilibrative glucose transport protein family. It???s surface expression is induced by insulin. It is restricted in humans to brain, testis (in the spermatozoa), and skeletal muscle, mostly in triads of slow-twitch fibres. Detected only in the brain of mouse and rat. IHC demonstrates its present in neurons, mainly at the plasma membrane, and to a lesser extent on intracellular vesicles distinct from synaptic vesicles. Present in the a-granules of human platelets, where it is translocated to the cell surface in response to thrombin stimulation. Its surface expression is increased by insulin or insulin growth-factor in cultured L6 muscle cells.
Protein type: Transporter, SLC family; Transporter; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12p13.3
Cellular Component: integral to membrane; integral to plasma membrane; plasma membrane
Molecular Function: D-glucose transmembrane transporter activity; dehydroascorbic acid transporter activity; glucose binding; glucose transmembrane transporter activity
Biological Process: glucose transport; L-ascorbic acid metabolic process
Research Articles on SLC2A3
Similar Products
Product Notes
The SLC2A3 slc2a3 (Catalog #AAA1274525) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggacac agaaggtcac cccagctctg atatttgcca tcacagttgc tacaatcggc tctttccaat ttggctacaa cactggggtc atcaatgctc ctgagaagat cataaaggaa tttatcaata aaactttgac ggacaaggga aatgccccac cctctgaggt gctgctcacg tctctctggt ccttgtctgt ggccatattt tccgtcgggg gtatgatcgg ctccttttcc gtcggactct tcgtcaaccg ctttggcagg cgcaattcaa tgctgattgt caacctgttg gctgtcactg gtggctgctt tatgggactg tgtaaagtag ctaagtcggt tgaaatgctg atcctgggtc gcttggttat tggcctcttc tgcggactct gcacaggttt tgtgcccatg tacattggag agatctcgcc tactgccctg cggggtgcct ttggcactct caaccagctg ggcatcgttg ttggaattct ggtggcccag atctttggtc tggaattcat ccttgggtct gaagagctat ggccgctgct actgggtttt accatccttc ctgctatcct acaaagtgca gcccttccat tttgccctga aagtcccaga tttttgctca ttaacagaaa agaagaggag aatgctaagc agatcctcca gcggttgtgg ggcacccagg atgtatccca agacatccag gagatgaaag atgagagtgc aaggatgtca caagaaaagc aagtcaccgt gctagagctc tttagagtgt ccagctaccg acagcccatc atcatttcca ttgtgctcca gctctctcag cagctctctg ggatcaatgc tgtgttctat tactcaacag gaatcttcaa ggatgcaggt gttcaagagc ccatctatgc caccatcggc gcgggtgtgg ttaatactat cttcactgta gtttctctat ttctggtgga aagggcagga agaaggactc tgcatatgat aggccttgga gggatggctt tttgttccac gctcatgact gtttctttgt tattaaagga taactataat gggatgagct ttgtctgtat tggggctatc ttggtctttg tagccttctt tgaaattgga ccaggcccca ttccctggtt tattgtggcc gaactcttca gccagggccc ccgcccagct gcgatggcag tggccggctg ctccaactgg acctccaact tcctagtcgg attgctcttc ccctccgctg ctcactattt aggagcctac gtttttatta tcttcaccgg cttcctcatt accttcttgg cttttacctt cttcaaagtc cctgagaccc gtggcaggac ttttgaggat atcacacggg cctttgaagg gcaggcacac ggtgcagata gatctggaaa ggacggcgtc atggagatga acagcatcga gcctgctaag gagaccacca ccaatgtcta a. It is sometimes possible for the material contained within the vial of "SLC2A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
