Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC29A2 cdna clone

SLC29A2 cDNA Clone

Gene Names
SLC29A2; ENT2; DER12; HNP36
Synonyms
SLC29A2; SLC29A2 cDNA Clone; SLC29A2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcgaggagacgccccgcgggacagctaccacctggtcgggatcagcttcttcatcctggggctgggcaccctccttccctggaacttcttcatcaccgccatcccgtacttccaggcgcgactggccggggccggcaacagcacagccaggatcctgagcaccaaccacacgggtcccgaggatgccttcaacttcaaccattgggtgacgctgctgtcccagctgcccctgctgctcttcaccctcctcaactccttcctgtaccagtgcgtcccggagacggtgcgcattctgggcagcctgctggccatactgctgctctttgccctgacagcagcgctggtcaaggtggacatgagccccggacccttcttctccatcaccatggcctccgtctgcttcatcaactccttcagtgcagtcctacagggcagcctcttcgggcagctgggcaccatgccctccacctacagcaccctcttcctcagcggccagggcctggctgggatctttgctgcccttgccatgctcctggccatggccagtggcgtggacgccgagacctctgccctggggtactttatcacgccctgtgtgggcatcctcatgtccatcgtgtgttacctgagcctgcctcacctgaagtttgcccgctactacctggccaataaatcatcccaggcccaagctcaggagctggagaccaaagctgagctcctccagtctgatctggctgacagcgctgtgccttgtgttggtcttcacagtcaccctgtccgtcttccccgccatcacagccatggtgaccagctccaccagtcctgggaagtggagtcagttcttcaaccccatctgctgcttcctcctcttcaacatcatggactggctgggacggagcctgacctcttacttcctgtggccagacgaggacagccggctgctgcccctgctggtctgcctgcggttcctgttcgtgcccctcttcatgctgtgccacgtgccccagaggtcccggctgcccatcctcttcccacaggatgcctacttcatcaccttcatgctgctctttgccgtttctaa
Sequence Length
1086
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,507 Da
NCBI Official Full Name
Homo sapiens solute carrier family 29 (nucleoside transporters), member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 29 member 2
NCBI Official Symbol
SLC29A2
NCBI Official Synonym Symbols
ENT2; DER12; HNP36
NCBI Protein Information
equilibrative nucleoside transporter 2
UniProt Protein Name
Equilibrative nucleoside transporter 2
UniProt Gene Name
SLC29A2
UniProt Synonym Gene Names
DER12; ENT2; HNP36; Equilibrative NBMPR-insensitive nucleoside transporter
UniProt Entry Name
S29A2_HUMAN

NCBI Description

The uptake of nucleosides by transporters, such as SLC29A2, is essential for nucleotide synthesis by salvage pathways in cells that lack de novo biosynthetic pathways. Nucleoside transport also plays a key role in the regulation of many physiologic processes through its effect on adenosine concentration at the cell surface (Griffiths et al., 1997 [PubMed 9396714]).[supplied by OMIM, Nov 2008]

Uniprot Description

SLC29A2: Mediates equilibrative transport of purine, pyrimidine nucleosides and the purine base hypoxanthine. Very less sensitive than SLC29A1 to inhibition by nitrobenzylthioinosine (NBMPR), dipyridamole, dilazep and draflazine. Belongs to the SLC29A/ENT transporter (TC 2.A.57) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Membrane protein, multi-pass; Membrane protein, integral; Transporter, SLC family

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: basolateral plasma membrane; nucleolus; plasma membrane

Molecular Function: nucleoside transmembrane transporter activity

Biological Process: cell proliferation; nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; nucleoside transport

Research Articles on SLC29A2

Similar Products

Product Notes

The SLC29A2 slc29a2 (Catalog #AAA1268296) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcgag gagacgcccc gcgggacagc taccacctgg tcgggatcag cttcttcatc ctggggctgg gcaccctcct tccctggaac ttcttcatca ccgccatccc gtacttccag gcgcgactgg ccggggccgg caacagcaca gccaggatcc tgagcaccaa ccacacgggt cccgaggatg ccttcaactt caaccattgg gtgacgctgc tgtcccagct gcccctgctg ctcttcaccc tcctcaactc cttcctgtac cagtgcgtcc cggagacggt gcgcattctg ggcagcctgc tggccatact gctgctcttt gccctgacag cagcgctggt caaggtggac atgagccccg gacccttctt ctccatcacc atggcctccg tctgcttcat caactccttc agtgcagtcc tacagggcag cctcttcggg cagctgggca ccatgccctc cacctacagc accctcttcc tcagcggcca gggcctggct gggatctttg ctgcccttgc catgctcctg gccatggcca gtggcgtgga cgccgagacc tctgccctgg ggtactttat cacgccctgt gtgggcatcc tcatgtccat cgtgtgttac ctgagcctgc ctcacctgaa gtttgcccgc tactacctgg ccaataaatc atcccaggcc caagctcagg agctggagac caaagctgag ctcctccagt ctgatctggc tgacagcgct gtgccttgtg ttggtcttca cagtcaccct gtccgtcttc cccgccatca cagccatggt gaccagctcc accagtcctg ggaagtggag tcagttcttc aaccccatct gctgcttcct cctcttcaac atcatggact ggctgggacg gagcctgacc tcttacttcc tgtggccaga cgaggacagc cggctgctgc ccctgctggt ctgcctgcgg ttcctgttcg tgcccctctt catgctgtgc cacgtgcccc agaggtcccg gctgcccatc ctcttcccac aggatgccta cttcatcacc ttcatgctgc tctttgccgt ttctaa. It is sometimes possible for the material contained within the vial of "SLC29A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.