Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC26A8 cdna clone

SLC26A8 cDNA Clone

Gene Names
SLC26A8; TAT1; SPGF3
Synonyms
SLC26A8; SLC26A8 cDNA Clone; SLC26A8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacaactagagaggagcgccatctctggcttcagctctaagtccaggcgaaactcattcgcatatgatgttaagcgtgaagtatacaatgaggagacctttcaacaggaacacaaaaggaaggcctcctcttctgggaacatgaacatcaacatcaccaccttcagacaccacgtccagtgccgctgctcatggcacaggttcctacgatgcatgcttacaatctttcccttcctagaatggatgtgtatgtatcgattaaaggattggcttctgggagacttacttgctggtataagtgttggccttgtgcaagttccccaaggcctgacacttagtttgctggcaaggcaactgattcctcctctcaacatcgcttatgcagctttctgttcttcggtaatctatgtaatttttggatcgtgtcatcaaatgtccattggttccttcttcctggtgagtgctctgctgatcaacgttctgaaagtgagcccattcaacaacggtcaactggtcatgggatctttcgtcaagaatgagttttcggccccctcctaccttatgggctataataaatccttgagtgtggtggcaaccacaacttttctgactgggattattcagattattggcttcactgtgattgcaaacaagataagcatggccacagaaaccagccagacgcttattgacatgattccttatagctttctgcttcctgtaacaccagatttcagccttcttcccaagataattttacaagccttctccttatctttggtgagctcctttctgctcatatttctgggcaagaagattgccagtcttcacaattacagtgtcaattccaaccaggatttaatagccatcggcctttgcaatgtcgtcagttcatttttcagatcttgtgtgtttactggtgctattgctaggactattatccaggataaatctggaggaagacaacagtttgcatctctggtaggcgcaggtgtgatgctgctcctgatggtgaagatgggacactttttctacacactgccaaatgctgtgctggctggtattattctgagcaacgtcattccctaccttgaaaccatttctaacctacccagcctgtggaggcaggaccaatatgactgtgctctttggatgatgacattctcatcttcaattttcctgggactggacattggactaattatctcagtagtttctgctttcttcatcaccactgttcgttcacacagagctaagattcttctcctgggtcaaatccctaacaccaacatttatagaagcatcaatgattatcgggagatcatcaccattcctggggtgaaaatcttccagtgctgcagctcaattacatttgtaaatgtttactacctaaagcataagctgttaaaagaggttgatatggtaaaggtgcctcttaaagaagaagaaattttcagcttgtttaattcaagtgacaccaatctacaaggaggaaagatttgcaggtgtttctgcaactgtgatgatctggagccgctgcccaggattctttacacagagcgatttgaaaataaactggatcccgaagcatcctccgttaacctgattcactgctcacattttgagagcatgaacacaagccaaactgcatccgaagaccaagtgccatacacagtatcgtccgtgtctcagaaaaatcaagggcaacagtatgaggaggtggaggaagtttggcttcctaataactcatcaagaaacagctcaccaggactgcctgatgtggcggaaagccaggggaggagatcactcatcccttactcagatgcgtctctactgcccagtgtccacaccatcatcctggatttctccatggtacactacgtggattcacgggggttagtcgtattaagacagatatgcaatgcctttcaaaacgccaacattttgatactcattgcagggtgtcactcttccatagtcagggcatttgagaggaatgatttctttgacgctggcatcaccaagacccagctgttcctcagcgttcacgacgccgtgctgtttgccttgtcaaggaaggtcataggctcctctgagttaagcatcgatgaatccgagacagtgatacgggaaacctactcagaaacagacaagaatgacaattcaagatataaaatgagcagcagttttctaggaagccaaaaaaatgtaagtccaggcttcatcaagatccaacagcctgtagaagaggagtcggagttggatttggagctggaatcagaacaagaggctgggctgggtctggacctagacctggatcgggagctggagcctgaaatggagcccaaggctgagaccgagaccaagacccagaccgagatggagccccagcctgagactgagcctgagatggagcccaaccccaaatctaggccaagagctcacacttttcctcagcagcgttactggcctatgtatcatccgtctatggcttccacccagtctcagactcagactcggacatggtcagtggagaggagacgccatcctatggattcatactcaccagagggcaacagcaatgaagatgtctag
Sequence Length
2598
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,680 Da
NCBI Official Full Name
Homo sapiens solute carrier family 26, member 8, mRNA
NCBI Official Synonym Full Names
solute carrier family 26 member 8
NCBI Official Symbol
SLC26A8
NCBI Official Synonym Symbols
TAT1; SPGF3
NCBI Protein Information
testis anion transporter 1
UniProt Protein Name
Testis anion transporter 1
Protein Family
UniProt Gene Name
SLC26A8
UniProt Entry Name
S26A8_HUMAN

NCBI Description

This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]

Uniprot Description

SLC26A8: Acts as a DIDS-sensitive anion exchanger mediating chloride, sulfate and oxalate transport. May fulfill critical anion exchange functions in male germ line during meiosis and hence may play a role in spermatogenesis. May be involved in a new regulatory pathway linking sulfate transport to RhoGTPase signaling in male germ cells. A critical component of the sperm annulus that is essential for correct sperm tail differentiation and motility and hence male fertility. Belongs to the SLC26A/SulP transporter (TC 2.A.53) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter; Membrane protein, multi-pass; Transporter, SLC family

Chromosomal Location of Human Ortholog: 6p21

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: anion:anion antiporter activity; bicarbonate transmembrane transporter activity; chloride channel activity; oxalate transmembrane transporter activity; protein binding; sulfate transmembrane transporter activity

Biological Process: anion transport; bicarbonate transport; chloride transport; oxalate transport; regulation of intracellular pH; regulation of membrane potential; sulfate transport

Disease: Spermatogenic Failure 3

Research Articles on SLC26A8

Similar Products

Product Notes

The SLC26A8 slc26a8 (Catalog #AAA1266667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacaac tagagaggag cgccatctct ggcttcagct ctaagtccag gcgaaactca ttcgcatatg atgttaagcg tgaagtatac aatgaggaga cctttcaaca ggaacacaaa aggaaggcct cctcttctgg gaacatgaac atcaacatca ccaccttcag acaccacgtc cagtgccgct gctcatggca caggttccta cgatgcatgc ttacaatctt tcccttccta gaatggatgt gtatgtatcg attaaaggat tggcttctgg gagacttact tgctggtata agtgttggcc ttgtgcaagt tccccaaggc ctgacactta gtttgctggc aaggcaactg attcctcctc tcaacatcgc ttatgcagct ttctgttctt cggtaatcta tgtaattttt ggatcgtgtc atcaaatgtc cattggttcc ttcttcctgg tgagtgctct gctgatcaac gttctgaaag tgagcccatt caacaacggt caactggtca tgggatcttt cgtcaagaat gagttttcgg ccccctccta ccttatgggc tataataaat ccttgagtgt ggtggcaacc acaacttttc tgactgggat tattcagatt attggcttca ctgtgattgc aaacaagata agcatggcca cagaaaccag ccagacgctt attgacatga ttccttatag ctttctgctt cctgtaacac cagatttcag ccttcttccc aagataattt tacaagcctt ctccttatct ttggtgagct cctttctgct catatttctg ggcaagaaga ttgccagtct tcacaattac agtgtcaatt ccaaccagga tttaatagcc atcggccttt gcaatgtcgt cagttcattt ttcagatctt gtgtgtttac tggtgctatt gctaggacta ttatccagga taaatctgga ggaagacaac agtttgcatc tctggtaggc gcaggtgtga tgctgctcct gatggtgaag atgggacact ttttctacac actgccaaat gctgtgctgg ctggtattat tctgagcaac gtcattccct accttgaaac catttctaac ctacccagcc tgtggaggca ggaccaatat gactgtgctc tttggatgat gacattctca tcttcaattt tcctgggact ggacattgga ctaattatct cagtagtttc tgctttcttc atcaccactg ttcgttcaca cagagctaag attcttctcc tgggtcaaat ccctaacacc aacatttata gaagcatcaa tgattatcgg gagatcatca ccattcctgg ggtgaaaatc ttccagtgct gcagctcaat tacatttgta aatgtttact acctaaagca taagctgtta aaagaggttg atatggtaaa ggtgcctctt aaagaagaag aaattttcag cttgtttaat tcaagtgaca ccaatctaca aggaggaaag atttgcaggt gtttctgcaa ctgtgatgat ctggagccgc tgcccaggat tctttacaca gagcgatttg aaaataaact ggatcccgaa gcatcctccg ttaacctgat tcactgctca cattttgaga gcatgaacac aagccaaact gcatccgaag accaagtgcc atacacagta tcgtccgtgt ctcagaaaaa tcaagggcaa cagtatgagg aggtggagga agtttggctt cctaataact catcaagaaa cagctcacca ggactgcctg atgtggcgga aagccagggg aggagatcac tcatccctta ctcagatgcg tctctactgc ccagtgtcca caccatcatc ctggatttct ccatggtaca ctacgtggat tcacgggggt tagtcgtatt aagacagata tgcaatgcct ttcaaaacgc caacattttg atactcattg cagggtgtca ctcttccata gtcagggcat ttgagaggaa tgatttcttt gacgctggca tcaccaagac ccagctgttc ctcagcgttc acgacgccgt gctgtttgcc ttgtcaagga aggtcatagg ctcctctgag ttaagcatcg atgaatccga gacagtgata cgggaaacct actcagaaac agacaagaat gacaattcaa gatataaaat gagcagcagt tttctaggaa gccaaaaaaa tgtaagtcca ggcttcatca agatccaaca gcctgtagaa gaggagtcgg agttggattt ggagctggaa tcagaacaag aggctgggct gggtctggac ctagacctgg atcgggagct ggagcctgaa atggagccca aggctgagac cgagaccaag acccagaccg agatggagcc ccagcctgag actgagcctg agatggagcc caaccccaaa tctaggccaa gagctcacac ttttcctcag cagcgttact ggcctatgta tcatccgtct atggcttcca cccagtctca gactcagact cggacatggt cagtggagag gagacgccat cctatggatt catactcacc agagggcaac agcaatgaag atgtctag. It is sometimes possible for the material contained within the vial of "SLC26A8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.