Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC25A13 cdna clone

SLC25A13 cDNA Clone

Gene Names
SLC25A13; CTLN2; CITRIN; ARALAR2
Synonyms
SLC25A13; SLC25A13 cDNA Clone; SLC25A13 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccgccaaggtggctttaaccaagagagcagatccagctgagcttagaacaatatttttgaagtatgcaagcattgagaaaaacggtgaatttttcatgtcccccaatgactttgtcactcgatacttgaacatttttggagaaagccagcctaatccaaagactgtggaacttttaagtggagtggtggatcagaccaaagatggattaatatcttttcaagaatttgttgcctttgaatctgtcctgtgtgcccctgatgctttgtttatggtagcctttcagctgtttgacaaagctggcaaaggagaagtaacttttgaggatgttaagcaagtttttggacagaccacaattcatcaacatattccatttaactgggattcagaatttgtgcaactacattttggaaaagaaagaaaaagacacctgacatatgcggaatttactcagtttttattggaaatacaactggagcacgcaaagcaagcctttgtgcaacgggacaatgctaggactgggagagtcacagccatcgacttccgagacatcatggtcaccatccgcccccatgtcttgactccttttgtagaagaatgtctagtagctgctgctggaggtaccacatcccatcaagttagtttctcctattttaatggatttaattcgctccttaacaacatggaactcattagaaagatctatagcactctggctggcaccaggaaagatgttgaagtgactaaggaggagtttgttctggcagctcagaaatttggtcaggttacacccatggaagttgacatcttgtttcagttagcagatttatatgagccaaggggacgtatgaccttagcagacattgaacggattgctcctctggaagagggaactctgccctttaacttggctgaggcccagaggcagaaggcctcaggtgattcagctcgaccagttcttctacaagttgcagagtcggcctacaggtttggtctgggttctgttgctggagctgttggagccactgctgtgtatcctatcgatcttgtaaaaactcgaatgcagaaccaacgatcaactggctcttttgtgggagaactcatgtataaaaacagctttgactgttttaagaaagtgctacgctatgaaggcttctttggactgtatagaggtctgttgccacagttattgggagttgccccagagaaggccataaaacttacagtgaacgattttgtgagggataaatttatgcacaaagatggttcggtcccacttgcagcagaaattcttgctggaggctgcgctggaggctcccaggtgattttcacaaatcctttagaaatcgtcaagatccgtttgcaagtggcaggagaaatcaccactggtcctcgagtcagtgctctgtctgtcgtgcgggacctggggttttttgggatctacaagggtgccaaagcatgctttctgcgggacattcctttctcggccatctactttccgtgctatgctcatgtgaaggcttcctttgcaaatgaagatgggcaggttagcccaggaagcctgctcttagctggtgccatagctggtatgcctgcagcatctttagtgacccctgctgatgttatcaagacgagattacaggtggctgcccgggctggccaaaccacttacagcggagtgatagactgctttagaaagatactgcgtgaagaaggaccaaaagctctgtggaagggagctggtgctcgtgtatttcgatcctcaccccagtttggtgtaactttgctgacttacgaattgctacagcgatggttctacattgattttggaggagtaaaacccatgggatcagagccagttcctaaatccaggatcaacctgcctgccccgaatcctgatcacgttgggggctacaaactggcagttgctacatttgcagggattgaaaacaaatttggactttacctacctctcttcaagccatcagtatctacctcaaaggctattggtggaggcccatag
Sequence Length
2028
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,304 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25, member 13 (citrin), mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 13
NCBI Official Symbol
SLC25A13
NCBI Official Synonym Symbols
CTLN2; CITRIN; ARALAR2
NCBI Protein Information
calcium-binding mitochondrial carrier protein Aralar2
UniProt Protein Name
Calcium-binding mitochondrial carrier protein Aralar2
UniProt Gene Name
SLC25A13
UniProt Synonym Gene Names
ARALAR2
UniProt Entry Name
CMC2_HUMAN

NCBI Description

This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

Uniprot Description

SLC25A13: Catalyzes the calcium-dependent exchange of cytoplasmic glutamate with mitochondrial aspartate across the mitochondrial inner membrane. May have a function in the urea cycle. Defects in SLC25A13 are the cause of citrullinemia type 2 (CTLN2). Citrullinemia belongs to the urea cycle disorders. It is an autosomal recessive disease characterized primarily by elevated serum and urine citrulline levels. Ammonia intoxication is another manifestation. CTLN2 is characterized by neuropsychiatric symptoms including abnormal behaviors, loss of memory, seizures and coma. Death can result from brain edema. Onset is sudden and usually between the ages of 20 and 50 years. Defects in SLC25A13 are the cause of neonatal intrahepatic cholestasis due to citrin deficiency (NICCD). NICCD is a form of citrullinemia type 2 with neonatal onset. NICCD is characterized by suppression of the bile flow, hepatic fibrosis, low birth weight, growth retardation, hypoproteinemia, variable liver dysfunction. NICCD is generally not severe and symptoms disappear by one year of age with an appropriate diet. Years or even decades later, however, some individuals develop the characteristic features of citrullinemia type 2 with neuropsychiatric symptoms. Belongs to the mitochondrial carrier family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Transporter; Transporter, SLC family; Mitochondrial

Chromosomal Location of Human Ortholog: 7q21.3

Cellular Component: mitochondrial inner membrane; mitochondrion

Molecular Function: acidic amino acid transmembrane transporter activity; calcium ion binding; L-aspartate transmembrane transporter activity; L-glutamate transmembrane transporter activity; structural constituent of ribosome

Biological Process: aspartate transport; ATP biosynthetic process; cellular respiration; gluconeogenesis; L-glutamate transport; malate-aspartate shuttle; response to calcium ion; translation

Disease: Citrullinemia, Type Ii, Adult-onset; Citrullinemia, Type Ii, Neonatal-onset

Research Articles on SLC25A13

Similar Products

Product Notes

The SLC25A13 slc25a13 (Catalog #AAA1275600) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccg ccaaggtggc tttaaccaag agagcagatc cagctgagct tagaacaata tttttgaagt atgcaagcat tgagaaaaac ggtgaatttt tcatgtcccc caatgacttt gtcactcgat acttgaacat ttttggagaa agccagccta atccaaagac tgtggaactt ttaagtggag tggtggatca gaccaaagat ggattaatat cttttcaaga atttgttgcc tttgaatctg tcctgtgtgc ccctgatgct ttgtttatgg tagcctttca gctgtttgac aaagctggca aaggagaagt aacttttgag gatgttaagc aagtttttgg acagaccaca attcatcaac atattccatt taactgggat tcagaatttg tgcaactaca ttttggaaaa gaaagaaaaa gacacctgac atatgcggaa tttactcagt ttttattgga aatacaactg gagcacgcaa agcaagcctt tgtgcaacgg gacaatgcta ggactgggag agtcacagcc atcgacttcc gagacatcat ggtcaccatc cgcccccatg tcttgactcc ttttgtagaa gaatgtctag tagctgctgc tggaggtacc acatcccatc aagttagttt ctcctatttt aatggattta attcgctcct taacaacatg gaactcatta gaaagatcta tagcactctg gctggcacca ggaaagatgt tgaagtgact aaggaggagt ttgttctggc agctcagaaa tttggtcagg ttacacccat ggaagttgac atcttgtttc agttagcaga tttatatgag ccaaggggac gtatgacctt agcagacatt gaacggattg ctcctctgga agagggaact ctgcccttta acttggctga ggcccagagg cagaaggcct caggtgattc agctcgacca gttcttctac aagttgcaga gtcggcctac aggtttggtc tgggttctgt tgctggagct gttggagcca ctgctgtgta tcctatcgat cttgtaaaaa ctcgaatgca gaaccaacga tcaactggct cttttgtggg agaactcatg tataaaaaca gctttgactg ttttaagaaa gtgctacgct atgaaggctt ctttggactg tatagaggtc tgttgccaca gttattggga gttgccccag agaaggccat aaaacttaca gtgaacgatt ttgtgaggga taaatttatg cacaaagatg gttcggtccc acttgcagca gaaattcttg ctggaggctg cgctggaggc tcccaggtga ttttcacaaa tcctttagaa atcgtcaaga tccgtttgca agtggcagga gaaatcacca ctggtcctcg agtcagtgct ctgtctgtcg tgcgggacct ggggtttttt gggatctaca agggtgccaa agcatgcttt ctgcgggaca ttcctttctc ggccatctac tttccgtgct atgctcatgt gaaggcttcc tttgcaaatg aagatgggca ggttagccca ggaagcctgc tcttagctgg tgccatagct ggtatgcctg cagcatcttt agtgacccct gctgatgtta tcaagacgag attacaggtg gctgcccggg ctggccaaac cacttacagc ggagtgatag actgctttag aaagatactg cgtgaagaag gaccaaaagc tctgtggaag ggagctggtg ctcgtgtatt tcgatcctca ccccagtttg gtgtaacttt gctgacttac gaattgctac agcgatggtt ctacattgat tttggaggag taaaacccat gggatcagag ccagttccta aatccaggat caacctgcct gccccgaatc ctgatcacgt tgggggctac aaactggcag ttgctacatt tgcagggatt gaaaacaaat ttggacttta cctacctctc ttcaagccat cagtatctac ctcaaaggct attggtggag gcccatag. It is sometimes possible for the material contained within the vial of "SLC25A13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.